ROUGE

Gene/Protein Characteristic Table for mKIAA0110

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220322
Description :	MAD2L1 binding protein.
Clone Name :	mbp01112 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 920 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 66 bp

Genome contig ID gi65550231r_43557628
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CTTCTCATGCTAGGGCACCCATCTTCCCACTGAGG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
GAGGAGGAAGGCTCTGTCCTGGCCATGTGCCTTCTCTCCCCAGACTTCCT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0110 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0110	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..854
Length: 283 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAH05768	9.4e-119	100.0	MAD2L1 binding ...	Mus musculus
Q9DCX1	2e-118	99.6	MAD2L1-binding ...	Mus musculus
BAB22054	2e-117	98.9	unnamed protein...	Mus musculus
AAH88268	7.4e-107	91.7	MAD2L1 binding ...	Rattus norvegicus
XP_532151	2.5e-88	77.4	similar to MAD2...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR009511 19 283 PF06581 MAD2L1 binding protein

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR009511	19	283	PF06581	MAD2L1 binding protein

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	66 bp
Genome contig ID	gi65550231r_43557628
PolyA signal sequence (None)	+--------+--------+----*----+---- CTTCTCATGCTAGGGCACCCATCTTCCCACTGAGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* GAGGAGGAAGGCTCTGTCCTGGCCATGTGCCTTCTCTCCCCAGACTTCCT

Gene/Protein Characteristic Table for mKIAA0110

Features of the cloned DNA sequence

Features of the protein sequence