ROUGE |
Gene/Protein Characteristic Table for mKIAA0110 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK220322 |
---|---|
MAD2L1 binding protein. | |
mbp01112 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 920 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 66 bp Genome contig ID gi65550231r_43557628 PolyA signal sequence
(None) +----*----+----*----+----*----+----
CTTCTCATGCTAGGGCACCCATCTTCCCACTGAGGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
GAGGAGGAAGGCTCTGTCCTGGCCATGTGCCTTCTCTCCCCAGACTTCCT
KIAA Alignment based on: KIAA0110 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 3..854
Length: 283 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage ![]() | |