Order Kazusa clone(s) from : ![]() |
Product ID | ORK00019 |
---|---|
Accession No | D14811 |
Description | MAD2L1 binding protein, transcript variant 2 |
Clone name | ha00666 |
Vector information | |
cDNA sequence | DNA sequence (1233 bp) Predicted protein sequence (275 aa) |
HaloTag ORF Clone |
FHC00019
![]() |
Flexi ORF Clone | FXC00019 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0110
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 405 bp |
---|---|
Genome contig ID | gi89161210f_43611588 |
PolyA signal sequence (AATAAA,-18) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (105067 - 105116) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 6 | f | 43711588 | 43716653 | 3 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | NULL | 2 | 275 | PD125087 | NULL |
HMMPfam | IPR009511 | 10 | 275 | PF06581 | MAD2L1 binding protein |
Panel name | Stanford G3 |
---|---|
Primer_f | GCTGTGACTGTGACTGTAATC |
Primer_r | CACAGCAAAGAGCAGAAAGGG |
PCR product length | 159 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |