ROUGE |
Gene/Protein Characteristic Table for mKIAA0089 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK172886 |
---|---|
mfj52294 [Vector Info] | |
Source : | Mouse fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4335 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 3064 bp Genome contig ID gi65519420r_114773184 PolyA signal sequence
(AATAAA,-29) +----*----+----*----+----*----+----
TTAATTAATAAATACAGAATTTTAATATTTATATTFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
ATAACTTGATTGTTGTATTTTATAGGTATGGATGTATTTGGCCTGCATGT
KIAA Alignment based on: KIAA0089 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 180..1271
Length: 363 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR006109 | 209 | 358 | PD001278 | NAD-dependent glycerol-3-phosphate dehydrogenase |
FPrintScan | IPR006168 | 22 | 39 | PR00077 | NAD-dependent glycerol-3-phosphate dehydrogenase |
IPR006168 | 84 | 111 | PR00077 | NAD-dependent glycerol-3-phosphate dehydrogenase | |
IPR006168 | 160 | 180 | PR00077 | NAD-dependent glycerol-3-phosphate dehydrogenase | |
IPR006168 | 200 | 224 | PR00077 | NAD-dependent glycerol-3-phosphate dehydrogenase | |
IPR006168 | 225 | 249 | PR00077 | NAD-dependent glycerol-3-phosphate dehydrogenase | |
IPR006168 | 268 | 285 | PR00077 | NAD-dependent glycerol-3-phosphate dehydrogenase | |
HMMPfam | IPR011128 | 18 | 189 | PF01210 | NAD-dependent glycerol-3-phosphate dehydrogenase |
IPR006109 | 206 | 356 | PF07479 | NAD-dependent glycerol-3-phosphate dehydrogenase |
Method | From | To | amino acid sequence |
---|---|---|---|
- | - | - | - |
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage ![]() | |