ROUGE

Gene/Protein Characteristic Table for mKIAA4010

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220445
Description :	Glycerol-3-phosphate dehydrogenase [NAD+], cytoplasmic.
Clone Name :	mbj00682 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 2742 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1683 bp

Genome contig ID gi65543215f_99674816
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
CCACTTGTCTACCCAATAAAGTGTGGTTTTTCCAG
Flanking genome sequence
(107408 - 107457)
----+----*----+----*----+----*----+----*----+----*
AAACTGGAAGAGTTGGGGGAGTTTATGTGGCAGTGTGTGGGGTCATGTAT

Genomic structure deduced by Blast search against draft genome sequences

Features of the protein sequence	Description

Coding region: 1..1056
Length: 352 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAA37726	2.9e-143	100.0	glycerol-3-phos...	Mus musculus
P13707	7.2e-143	99.7	Glycerol-3-phos...	Mus musculus
BAE23246	1.1e-142	99.4	unnamed protein...	Mus musculus
AAH05756	1.9e-140	99.7	Gpd1 protein [M...	Mus musculus
O35077	4.7e-140	97.7	Glycerol-3-phos...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK172886	1.3e-115	73.6	mKIAA0089

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR006109 188 345 PD001278 NAD-dependent glycerol-3-phosphate dehydrogenase

FPrintScan IPR006168 11 28 PR00077 NAD-dependent glycerol-3-phosphate dehydrogenase

IPR006168 73 100 PR00077 NAD-dependent glycerol-3-phosphate dehydrogenase

IPR006168 149 169 PR00077 NAD-dependent glycerol-3-phosphate dehydrogenase

IPR006168 189 213 PR00077 NAD-dependent glycerol-3-phosphate dehydrogenase

IPR006168 214 238 PR00077 NAD-dependent glycerol-3-phosphate dehydrogenase

IPR006168 257 274 PR00077 NAD-dependent glycerol-3-phosphate dehydrogenase

HMMPfam IPR011128 7 178 PF01210 NAD-dependent glycerol-3-phosphate dehydrogenase

IPR006109 195 345 PF07479 NAD-dependent glycerol-3-phosphate dehydrogenase

ScanRegExp IPR006168 204 225 PS00957 NAD-dependent glycerol-3-phosphate dehydrogenase

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR006109	188	345	PD001278	NAD-dependent glycerol-3-phosphate dehydrogenase
FPrintScan	IPR006168	11	28	PR00077	NAD-dependent glycerol-3-phosphate dehydrogenase
IPR006168	73	100	PR00077	NAD-dependent glycerol-3-phosphate dehydrogenase
IPR006168	149	169	PR00077	NAD-dependent glycerol-3-phosphate dehydrogenase
IPR006168	189	213	PR00077	NAD-dependent glycerol-3-phosphate dehydrogenase
IPR006168	214	238	PR00077	NAD-dependent glycerol-3-phosphate dehydrogenase
IPR006168	257	274	PR00077	NAD-dependent glycerol-3-phosphate dehydrogenase
HMMPfam	IPR011128	7	178	PF01210	NAD-dependent glycerol-3-phosphate dehydrogenase
IPR006109	195	345	PF07479	NAD-dependent glycerol-3-phosphate dehydrogenase
ScanRegExp	IPR006168	204	225	PS00957	NAD-dependent glycerol-3-phosphate dehydrogenase

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1683 bp
Genome contig ID	gi65543215f_99674816
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- CCACTTGTCTACCCAATAAAGTGTGGTTTTTCCAG
Flanking genome sequence (107408 - 107457)	----+--------+--------+--------+--------+----* AAACTGGAAGAGTTGGGGGAGTTTATGTGGCAGTGTGTGGGGTCATGTAT

Gene/Protein Characteristic Table for mKIAA4010

Features of the cloned DNA sequence

Features of the protein sequence