Order Kazusa clone(s) from : ![]() |
Product ID | ORK00011 |
---|---|
Accession No | D42047 |
Description | glycerol-3-phosphate dehydrogenase 1-like |
Clone name | ha03662 |
Vector information | |
cDNA sequence | DNA sequence (4043 bp) Predicted protein sequence (411 aa) |
Flexi ORF Clone | FXC00011 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0089
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 2806 bp |
---|---|
Genome contig ID | gi89161205f_32023027 |
PolyA signal sequence (AATAAA,-29) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (162184 - 162233) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 3 | f | 32123027 | 32185209 | 8 | 99.2 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR006109 | 263 | 408 | PD001278 | NAD-dependent glycerol-3-phosphate dehydrogenase |
FPrintScan | IPR006168 | 70 | 87 | PR00077 | NAD-dependent glycerol-3-phosphate dehydrogenase |
IPR006168 | 132 | 159 | PR00077 | NAD-dependent glycerol-3-phosphate dehydrogenase | |
IPR006168 | 208 | 228 | PR00077 | NAD-dependent glycerol-3-phosphate dehydrogenase | |
IPR006168 | 248 | 272 | PR00077 | NAD-dependent glycerol-3-phosphate dehydrogenase | |
IPR006168 | 273 | 297 | PR00077 | NAD-dependent glycerol-3-phosphate dehydrogenase | |
IPR006168 | 316 | 333 | PR00077 | NAD-dependent glycerol-3-phosphate dehydrogenase | |
HMMPfam | IPR011128 | 66 | 237 | PF01210 | NAD-dependent glycerol-3-phosphate dehydrogenase |
IPR006109 | 254 | 404 | PF07479 | NAD-dependent glycerol-3-phosphate dehydrogenase |
Panel name | Stanford G3 |
---|---|
Primer_f | ACTGAAGAGATTTTGGTGAGG |
Primer_r | TCAGAACCAACAATGCCACAG |
PCR product length | 146 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |