Gene/Protein Characteristic Table for mKIAA0020

Length: 1617 bp

Restriction map

Length of 3'UTR	125 bp
Genome contig ID	gi65553144r_26530123
PolyA signal sequence (TATAAA,-20)	+----*----+----*----+----*----+---- TAAAGGACCTATTTATATAAAATTGTTTCTAAAAG
Flanking genome sequence (100000 - 99951)	----+----*----+----*----+----*----+----*----+----* AGACCTTTGGTTTAATGTCAACTGTCTGATCTGTGAGACTGAGTACTACA

KIAA	Alignment based on:
KIAA0020	DNA sequence, AA sequence, Physical map

Coding region: 2..1492

Length: 496 aa

Entry Exp ID% Protein Source BAC34427 9.6e-200 100.0 unnamed protein... Mus musculus EDL41650 9.8e-200 100.0 DNA segment, Ch... Mus musculus EDL41649 2e-198 99.0 DNA segment, Ch... Mus musculus BAC40135 2.1e-191 98.7 unnamed protein... Mus musculus XP_215276 5.3e-186 92.1 similar to D19B... Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK122205 1.8e-09 20.5 mKIAA0099

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR012959	281	428	PF08144	CPL
HMMSmart	IPR001313	13	48	SM00025	Pumilio/Puf RNA-binding
	IPR001313	49	84	SM00025	Pumilio/Puf RNA-binding
	IPR001313	85	121	SM00025	Pumilio/Puf RNA-binding
	IPR001313	198	233	SM00025	Pumilio/Puf RNA-binding
	IPR001313	234	270	SM00025	Pumilio/Puf RNA-binding
	IPR001313	272	308	SM00025	Pumilio/Puf RNA-binding
ProfileScan	IPR001313	1	496	PS50302	Pumilio/Puf RNA-binding
	IPR001313	49	84	PS50303	Pumilio/Puf RNA-binding

Method	From	To	amino acid sequence
-	-	-	-