Order Kazusa clone(s) from : ![]() |
Product ID | ORK00367 |
---|---|
Accession No | D13645 |
Description | KIAA0020 |
Clone name | ha00602 |
Vector information | |
cDNA sequence | DNA sequence (2112 bp) Predicted protein sequence (647 aa) |
HaloTag ORF Clone |
FHC00367
![]() |
Flexi ORF Clone | FXC00367 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0020
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 167 bp |
---|---|
Genome contig ID | gi89161216r_2694178 |
PolyA signal sequence (TATAAA,-23) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (99986 - 99937) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 9 | r | 2794164 | 2828505 | 17 | 99.9 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR012959 | 432 | 579 | PF08144 | CPL |
HMMSmart | IPR001313 | 164 | 199 | SM00025 | Pumilio/Puf RNA-binding |
IPR001313 | 200 | 235 | SM00025 | Pumilio/Puf RNA-binding | |
IPR001313 | 236 | 272 | SM00025 | Pumilio/Puf RNA-binding | |
IPR001313 | 349 | 384 | SM00025 | Pumilio/Puf RNA-binding | |
IPR001313 | 385 | 421 | SM00025 | Pumilio/Puf RNA-binding | |
IPR001313 | 423 | 459 | SM00025 | Pumilio/Puf RNA-binding | |
ProfileScan | IPR001313 | 136 | 509 | PS50303 | Pumilio/Puf RNA-binding |
IPR001313 | 163 | 199 | PS50302 | Pumilio/Puf RNA-binding | |
IPR001313 | 200 | 235 | PS50302 | Pumilio/Puf RNA-binding | |
IPR001313 | 349 | 384 | PS50302 | Pumilio/Puf RNA-binding | |
IPR001313 | 423 | 459 | PS50302 | Pumilio/Puf RNA-binding | |
IPR001313 | 492 | 530 | PS50302 | Pumilio/Puf RNA-binding |
Panel name | Genebridge 4 |
---|---|
Primer_f | AAAGCACCAGCAAAGGAATAG |
Primer_r | TGGACCCTACCCCTTCTTTTC |
PCR product length | 134 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |