ROUGE

Gene/Protein Characteristic Table for mKIAA0015

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	BC042570
Description :	protein phosphatase 1F (PP2C domain containing). calcium/calmodulin-dependent protein kinase phosphatase. partner of PIX2.
Clone Name :	mpm11170 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 4284 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3340 bp

Genome contig ID gi65546577f_15584902
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
GCCCTGTACTGGTGTCAATAAACCATATATTCAAG
Flanking genome sequence
(113263 - 113312)
----+----*----+----*----+----*----+----*----+----*
ATTCCTGAGTGCCACTTGGATCTCTTCCCTGTGCGTCTGTCTATAGTTAA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0015 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0015	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..944
Length: 313 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q8CGA0	5.9e-134	100.0	Protein phospha...	Mus musculus
Q9WVR7	2e-123	93.0	Protein phospha...	Rattus norvegicus
EDK97433	1.4e-121	100.0	protein phospha...	Mus musculus
EDL77865	4.8e-113	93.4	protein phospha...	Rattus norvegicus
BAH11809	3.2e-108	83.6	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK122434	2.1e-69	56.0	mKIAA1072
AK220523	1.4e-16	31.7	mKIAA4175

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001932 13 264 PF00481 Protein phosphatase 2C-like

HMMSmart IPR001932 2 269 SM00332 Protein phosphatase 2C-like

IPR001932 29 271 SM00331 Protein phosphatase 2C-like

ProfileScan IPR001932 19 104 PS50169 Protein phosphatase 2C-like

IPR001932 111 274 PS50170 Protein phosphatase 2C-like

ScanRegExp IPR000222 51 59 PS01032 Protein phosphatase 2C

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001932	13	264	PF00481	Protein phosphatase 2C-like
HMMSmart	IPR001932	2	269	SM00332	Protein phosphatase 2C-like
IPR001932	29	271	SM00331	Protein phosphatase 2C-like
ProfileScan	IPR001932	19	104	PS50169	Protein phosphatase 2C-like
IPR001932	111	274	PS50170	Protein phosphatase 2C-like
ScanRegExp	IPR000222	51	59	PS01032	Protein phosphatase 2C

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3340 bp
Genome contig ID	gi65546577f_15584902
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- GCCCTGTACTGGTGTCAATAAACCATATATTCAAG
Flanking genome sequence (113263 - 113312)	----+--------+--------+--------+--------+----* ATTCCTGAGTGCCACTTGGATCTCTTCCCTGTGCGTCTGTCTATAGTTAA

Gene/Protein Characteristic Table for mKIAA0015

Features of the cloned DNA sequence

Features of the protein sequence