Gene/Protein Characteristic Table for mKIAA1072

Length: 5973 bp

Restriction map

Length of 3'UTR	3974 bp
Genome contig ID	gi65527427r_86854899
PolyA signal sequence (AATAAA,-17)	+----*----+----*----+----*----+---- AAATTTTGCCAATATCTTAATAAAACTCAGCAATT
Flanking genome sequence (100000 - 99951)	----+----*----+----*----+----*----+----*----+----* AAAAACCACCGGTTATTTGTCTTATTCTTAGAGGACAGCTGAGTCAGTTG

KIAA	Alignment based on:
KIAA1072	DNA sequence, AA sequence, Physical map

Coding region: 2..1999

Length: 665 aa

Entry Exp ID% Protein Source Q80TL0 0 100.0 Protein phospha... Mus musculus BAC29490 0 100.0 unnamed protein... Mus musculus Q80Z30 0 95.5 Protein phospha... Rattus norvegicus NP_055721 0 90.9 protein phospha... Homo sapiens AAM76058 0 90.9 partner of PIX ... Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID BC042570 3.3e-39 56.0 mKIAA0015 AK220523 1.8e-08 31.7 mKIAA4175

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001932	143	394	PF00481	Protein phosphatase 2C-like
HMMSmart	IPR001932	132	399	SM00332	Protein phosphatase 2C-like
ProfileScan	IPR000694	27	43	PS50099	Proline-rich region
	IPR001932	149	234	PS50169	Protein phosphatase 2C-like
	IPR001932	241	404	PS50170	Protein phosphatase 2C-like
ScanRegExp	IPR000222	181	189	PS01032	Protein phosphatase 2C

Method	From	To	amino acid sequence
-	-	-	-