| ROUGE |
Gene/Protein Characteristic Table for mKIAA4175 |
| Link to : HUGE | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AK220523 |
|---|---|
| protein phosphatase 1 (formerly 2C)-like. protein phosphatase 2C epsilon. protein phosphatase 2a, catalytic subunit, epsilon isoform. PP2C-epsilon. |
|
| mfj00074 [Vector Info] | |
| Source : | Mouse fetal brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 3962 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 2225 bp Genome contig ID gi65492966f_68887436 PolyA signal sequence
(None) +----*----+----*----+----*----+----
TTGCTTTGCAGAAGTAACTTATTTAACCAAATAGGFlanking genome sequence
(338483 - 338532) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAGAATATATTTCACTCCTTTCTTGCCTCTTCCCCCCTCCCG
Features of the protein sequence |
Description | |
Coding region: 655..1734
Length: 360 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage
| |