Gene/Protein Characteristic Table for mKIAA0010

Length: 4956 bp

Restriction map

Length of 3'UTR	1496 bp
Genome contig ID	gi65498774f_27919790
PolyA signal sequence (ATTAAA,-16)	+----*----+----*----+----*----+---- CTAATGGGTGAATATTTACATTAAATCTTTTCCCC
Flanking genome sequence (206761 - 206810)	----+----*----+----*----+----*----+----*----+----* AAGATTGTGTTGGAGTTTTGCCCCAGATCACTGGTCAGTTGTGTTCTGCT

KIAA	Alignment based on:
KIAA0010	DNA sequence, AA sequence, Physical map

Coding region: 200..3460

Length: 1086 aa

Entry Exp ID% Protein Source Q80U95 0 100.0 Ubiquitin-prote... Mus musculus BAC26709 0 99.9 unnamed protein... Mus musculus EDL37247 0 99.8 ubiquitin prote... Mus musculus XP_347040 0 97.4 similar to ubiq... Rattus norvegicus Q15386 0 93.4 Ubiquitin-prote... Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK220549 1.2e-31 32.7 mKIAA4216 AB093227 1.3e-31 32.4 mKIAA0312 AK122203 5.3e-30 32.7 mKIAA0093 AK220164 1.7e-28 31.3 mKIAA4011 AK129325 2.4e-28 31.4 mKIAA1301

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000048	49	69	PF00612	IQ calmodulin-binding region
	IPR000569	781	1086	PF00632	HECT
HMMSmart	IPR000048	47	69	SM00015	IQ calmodulin-binding region
	IPR000569	745	1086	SM00119	HECT
ProfileScan	IPR000048	48	77	PS50096	IQ calmodulin-binding region
	IPR000569	747	1086	PS50237	HECT

Method	From	To	amino acid sequence
-	-	-	-