ROUGE

Gene/Protein Characteristic Table for mKIAA4216

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220549
Description :	Ubiquitin-protein ligase E3A.
Clone Name :	mfj70377 [Vector Info]
Source :	Mouse fetal brain

Features of the cloned DNA sequence	Description

Length: 4810 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1797 bp

Genome contig ID gi65511124f_53407165
PolyA signal sequence
(AATAAA,-12)
+----*----+----*----+----*----+----
AATTAAGTGGGTATATTTTATAAAATAAATTCATG
Flanking genome sequence
(177818 - 177867)
----+----*----+----*----+----*----+----*----+----*
AAGAGATTTGTGTTCTTCAGTTTATTGTCACTACAGTATTGAAGTAGTTG

Genomic structure deduced by Blast search against draft genome sequences

Features of the protein sequence	Description

Coding region: 293..3010
Length: 906 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_035798	100.0	ubiquitin prote...	Mus musculus
NP_001029134	100.0	ubiquitin prote...	Mus musculus
AAB63361	98.5	E6-AP ubiquitin...	Mus musculus
O08759	98.5	Ubiquitin-prote...	Mus musculus
AAC83345	98.0	E6-AP ubiquitin...	Mus spretus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
BC043082	1.1e-48	37.7	mKIAA1593
AK122192	2.8e-47	36.4	mKIAA0032
AK220164	1e-31	33.5	mKIAA4011
AB093227	1.5e-31	34.0	mKIAA0312
AK122203	4.4e-31	34.1	mKIAA0093

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000569 607 906 PF00632 HECT

HMMSmart IPR000569 576 906 SM00119 HECT

ProfileScan IPR000569 578 906 PS50237 HECT

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000569	607	906	PF00632	HECT
HMMSmart	IPR000569	576	906	SM00119	HECT
ProfileScan	IPR000569	578	906	PS50237	HECT

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

SOSUI 643 665 FTLIGIVLGLAIYNNCILDVHFP

Method	From	To	amino acid sequence
SOSUI	643	665	FTLIGIVLGLAIYNNCILDVHFP

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1797 bp
Genome contig ID	gi65511124f_53407165
PolyA signal sequence (AATAAA,-12)	+--------+--------+----*----+---- AATTAAGTGGGTATATTTTATAAAATAAATTCATG
Flanking genome sequence (177818 - 177867)	----+--------+--------+--------+--------+----* AAGAGATTTGTGTTCTTCAGTTTATTGTCACTACAGTATTGAAGTAGTTG

Gene/Protein Characteristic Table for mKIAA4216

Features of the cloned DNA sequence

Features of the protein sequence