ROUGE

Gene/Protein Characteristic Table for mKIAA1301

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129325
Description :
Clone Name :	mbg18866 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 6415 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2047 bp

Genome contig ID gi65488608r_54018816
PolyA signal sequence
(AATACA,-25)
+----*----+----*----+----*----+----
ATTTGTCATGAATACAGTATATATTTAATTTTTGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAACTGCTTTTACTCGTTTGTATTTTTTCATCATAAGGAAAACAGAGCAT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1301 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1301	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..4368
Length: 1455 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q6I6G8	100.0	E3 ubiquitin-pr...	Mus musculus
EDL99066	98.0	similar to HECT...	Rattus norvegicus
Q9P2P5	94.4	E3 ubiquitin-pr...	Homo sapiens
XP_516001	94.2	HECT, C2 and WW...	Pan troglodytes
CAH18262	93.8	hypothetical pr...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK172932	3.6e-123	58.3	mKIAA0322
AK122203	1.7e-42	36.5	mKIAA0093
AK220164	4.9e-38	39.6	mKIAA4011
AB093227	2.1e-30	33.1	mKIAA0312
AK122534	2.6e-21	49.5	mKIAA1625

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR002349 692 705 PR00403 WW

IPR002349 707 721 PR00403 WW

HMMPfam IPR000008 64 159 PF00168 C2

IPR001202 692 721 PF00397 WW/Rsp5/WWP

IPR001202 870 899 PF00397 WW/Rsp5/WWP

IPR000569 1150 1455 PF00632 HECT

HMMSmart IPR000008 63 174 SM00239 C2

IPR001202 691 723 SM00456 WW/Rsp5/WWP

IPR001202 869 901 SM00456 WW/Rsp5/WWP

IPR000569 1118 1455 SM00119 HECT

ProfileScan IPR000008 49 159 PS50004 C2

IPR001202 690 723 PS50020 WW/Rsp5/WWP

IPR001202 868 901 PS50020 WW/Rsp5/WWP

IPR000569 1120 1455 PS50237 HECT

ScanRegExp IPR001202 696 721 PS01159 WW/Rsp5/WWP

IPR001202 874 899 PS01159 WW/Rsp5/WWP

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002349	692	705	PR00403	WW
IPR002349	707	721	PR00403	WW
HMMPfam	IPR000008	64	159	PF00168	C2
IPR001202	692	721	PF00397	WW/Rsp5/WWP
IPR001202	870	899	PF00397	WW/Rsp5/WWP
IPR000569	1150	1455	PF00632	HECT
HMMSmart	IPR000008	63	174	SM00239	C2
IPR001202	691	723	SM00456	WW/Rsp5/WWP
IPR001202	869	901	SM00456	WW/Rsp5/WWP
IPR000569	1118	1455	SM00119	HECT
ProfileScan	IPR000008	49	159	PS50004	C2
IPR001202	690	723	PS50020	WW/Rsp5/WWP
IPR001202	868	901	PS50020	WW/Rsp5/WWP
IPR000569	1120	1455	PS50237	HECT
ScanRegExp	IPR001202	696	721	PS01159	WW/Rsp5/WWP
IPR001202	874	899	PS01159	WW/Rsp5/WWP

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2047 bp
Genome contig ID	gi65488608r_54018816
PolyA signal sequence (AATACA,-25)	+--------+--------+----*----+---- ATTTGTCATGAATACAGTATATATTTAATTTTTGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAACTGCTTTTACTCGTTTGTATTTTTTCATCATAAGGAAAACAGAGCAT

Gene/Protein Characteristic Table for mKIAA1301

Features of the cloned DNA sequence

Features of the protein sequence