ROUGE

Gene/Protein Characteristic Table for mFLJ00385

Link to : NEDO \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK131185
Description :	Ig gamma-3 chain C region, membrane-bound form.
Clone Name :	msh01286 [Vector Info]
Source :	Mouse adult spleen

Features of the cloned DNA sequence	Description

Length: 2989 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 1216 bp

Genome contig ID gi65532617r_108729706
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
TTTTTTAATAATAATAAAACATCCTTCAACATTGT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAACACACTGTGTTCTTCCTCTGTAGACCAACCCCCACTCTCCTTGTAC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

FLJ00385 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
FLJ00385	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 862..1773
Length: 303 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD21435	5.9e-127	100.0	mFLJ00385 prote...	Mus musculus
P03987	1.8e-126	100.0	Ig gamma-3 chai...	Mus musculus
AAB59697	1.7e-96	100.0	immunoglobulin ...	Mus musculus
BAA11356	1.7e-96	100.0	Ig gamma-chain,...	Mus musculus
AAT74921	2.2e-96	100.0	anti-CMV coat p...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR003597 31 120 PF07654 Immunoglobulin C1 type

IPR007110 41 110 PF00047 Immunoglobulin-like

IPR003597 139 225 PF07654 Immunoglobulin C1 type

IPR007110 147 214 PF00047 Immunoglobulin-like

HMMSmart IPR003597 43 118 SM00407 Immunoglobulin C1 type

IPR003597 149 222 SM00407 Immunoglobulin C1 type

ProfileScan IPR007110 25 124 PS50835 Immunoglobulin-like

IPR007110 133 229 PS50835 Immunoglobulin-like

ScanRegExp IPR003006 210 216 PS00290 Immunoglobulin/major histocompatibility complex

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003597	31	120	PF07654	Immunoglobulin C1 type
IPR007110	41	110	PF00047	Immunoglobulin-like
IPR003597	139	225	PF07654	Immunoglobulin C1 type
IPR007110	147	214	PF00047	Immunoglobulin-like
HMMSmart	IPR003597	43	118	SM00407	Immunoglobulin C1 type
IPR003597	149	222	SM00407	Immunoglobulin C1 type
ProfileScan	IPR007110	25	124	PS50835	Immunoglobulin-like
IPR007110	133	229	PS50835	Immunoglobulin-like
ScanRegExp	IPR003006	210	216	PS00290	Immunoglobulin/major histocompatibility complex

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

SOSUI 255 276 ITIFISLFLLSVCYSASVTLFK

Method	From	To	amino acid sequence
SOSUI	255	276	ITIFISLFLLSVCYSASVTLFK

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	1216 bp
Genome contig ID	gi65532617r_108729706
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- TTTTTTAATAATAATAAAACATCCTTCAACATTGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAACACACTGTGTTCTTCCTCTGTAGACCAACCCCCACTCTCCTTGTAC

Gene/Protein Characteristic Table for mFLJ00385

Features of the cloned DNA sequence

Features of the protein sequence