ROUGE

Gene/Protein Characteristic Table for mFLJ00369

Link to : NEDO \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK131181
Description :	Rho guanine nucleotide exchange factor 1.
Clone Name :	msh02173 [Vector Info]
Source :	Mouse adult spleen

Features of the cloned DNA sequence	Description

Length: 3160 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 339 bp

Genome contig ID gi65511124f_19985069
PolyA signal sequence
(AATATA,-18)
+----*----+----*----+----*----+----
ACTGGAGGTTTATTTTTAATATATATTATCTAAGG
Flanking genome sequence
(119549 - 119598)
----+----*----+----*----+----*----+----*----+----*
AAAGATCTGTGTGTGTGAGGGCGTTGGGCAGTGCGCCCCATGTCTGGGCC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

FLJ00369 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
FLJ00369	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..2821
Length: 939 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD21431	100.0	mFLJ00369 prote...	Mus musculus
EDL24305	99.9	Rho guanine nuc...	Mus musculus
EDL24304	99.9	Rho guanine nuc...	Mus musculus
Q61210	99.9	Rho guanine nuc...	Mus musculus
AAG33860	99.8	LSC [Rattus nor...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK122267	3.8e-43	38.9	mKIAA0382
AK220337	4.8e-24	41.0	mKIAA0380
AB093254	3e-15	28.6	mKIAA0651
AK173325	3.5e-15	25.5	mKIAA1998
AK122480	9.7e-11	26.6	mKIAA1256

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000219 438 622 PF00621 DH

HMMSmart IPR000219 438 622 SM00325 DH

IPR001849 666 780 SM00233 Pleckstrin-like

ProfileScan IPR000219 434 623 PS50010 DH

IPR001849 665 778 PS50003 Pleckstrin-like

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000219	438	622	PF00621	DH
HMMSmart	IPR000219	438	622	SM00325	DH
IPR001849	666	780	SM00233	Pleckstrin-like
ProfileScan	IPR000219	434	623	PS50010	DH
IPR001849	665	778	PS50003	Pleckstrin-like

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	339 bp
Genome contig ID	gi65511124f_19985069
PolyA signal sequence (AATATA,-18)	+--------+--------+----*----+---- ACTGGAGGTTTATTTTTAATATATATTATCTAAGG
Flanking genome sequence (119549 - 119598)	----+--------+--------+--------+--------+----* AAAGATCTGTGTGTGTGAGGGCGTTGGGCAGTGCGCCCCATGTCTGGGCC

Gene/Protein Characteristic Table for mFLJ00369

Features of the cloned DNA sequence

Features of the protein sequence