| ROUGE |
Gene/Protein Characteristic Table for mKIAA0651 |
| Link to : HUGE | InGAP | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AB093254 |
|---|---|
| Lymphoid BLAST crisis-like 1. | |
| mbg06227 [Vector Info] | |
| Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4365 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1181 bp Genome contig ID gi65492966f_88265176 PolyA signal sequence
(ATTAAA,-20)
GCTGCTCAAACTCTTATTAAAAATCTTAAAATTGCFlanking genome sequence
(126741 - 126790)
AAGGCTGGAAATGAAGCGCCGTTCAGCCTCCAGCGGCTGTTAATGATGCA
KIAA Alignment based on: KIAA0651 DNA sequence, AA sequence
Features of the protein sequence |
Description | |
Coding region: 227..3184
Length: 985 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| HMMPfam | IPR002219 | 40 | 90 | PF00130 | Protein kinase C |
| IPR000219 | 240 | 432 | PF00621 | DH | |
| IPR001849 | 474 | 572 | PF00169 | Pleckstrin-like | |
| HMMSmart | IPR002219 | 40 | 86 | SM00109 | Protein kinase C |
| IPR000219 | 240 | 432 | SM00325 | DH | |
| IPR001849 | 474 | 574 | SM00233 | Pleckstrin-like | |
| ProfileScan | IPR002219 | 39 | 86 | PS50081 | Protein kinase C |
| IPR000219 | 236 | 433 | PS50010 | DH | |
| IPR001849 | 473 | 572 | PS50003 | Pleckstrin-like | |
| ScanRegExp | IPR002219 | 40 | 86 | PS00479 | Protein kinase C |
| Method | From | To | amino acid sequence |
|---|---|---|---|
| - | - | - | - |
|
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage 
| |
