ROUGE |
Gene/Protein Characteristic Table for mFLJ00344 |
Link to : NEDO | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AF364951 |
---|---|
msh20362 [Vector Info] | |
Source : | Mouse adult spleen |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3500 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 399 bp Genome contig ID gi65524842r_86715976 PolyA signal sequence
(AATAAA,-17) +----*----+----*----+----*----+----
TGCCACACGGGTGCGCTCAATAAATGTGAGAACAGFlanking genome sequence
(99890 - 99841) ----+----*----+----*----+----*----+----*----+----*
AAAAAGTCACTGTGTACCTAGAAGGTGTCAAACTATGAAAGCAAAATACG
KIAA Alignment based on: FLJ00344 DNA sequence, AA sequence
Features of the protein sequence |
Description | |
Coding region: 3..3101
Length: 1032 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |