| ROUGE |
Gene/Protein Characteristic Table for mKIAA1112 |
| Link to : HUGE | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AK122448 |
|---|---|
| mbg21942 [Vector Info] | |
| Source : | Mouse brain |
| Note : | We replaced mbg10993, former representative clones for mKIAA1112 with mbg21942. (2004/6/22) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 1753 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 909 bp Genome contig ID gi65488608f_34976527 PolyA signal sequence
(CATAAA,-23) +----*----+----*----+----*----+----
CACATTTAATTTCATAAAGAAACGAATGAAAAGTGFlanking genome sequence
(105556 - 105605) ----+----*----+----*----+----*----+----*----+----*
ACCTGGCTGCTGGTCAGCTGGTGGTGTGTGTCAATTTCTTGTGTGCTGTC
KIAA Alignment based on: KIAA1112 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 2..844
Length: 280 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage
| |