Gene/Protein Characteristic Table for mKIAA1112

Length: 1753 bp

Restriction map

Length of 3'UTR	909 bp
Genome contig ID	gi65488608f_34976527
PolyA signal sequence (CATAAA,-23)	+----*----+----*----+----*----+---- CACATTTAATTTCATAAAGAAACGAATGAAAAGTG
Flanking genome sequence (105556 - 105605)	----+----*----+----*----+----*----+----*----+----* ACCTGGCTGCTGGTCAGCTGGTGGTGTGTGTCAATTTCTTGTGTGCTGTC

KIAA	Alignment based on:
KIAA1112	DNA sequence, AA sequence, Physical map

Coding region: 2..844

Length: 280 aa

Entry Exp ID% Protein Source Q7TNR9 1.8e-112 100.0 Rho guanine nuc... Mus musculus EDL99302 1.8e-112 100.0 similar to Rho ... Rattus norvegicus BAE41480 1.8e-112 100.0 unnamed protein... Mus musculus EDL99303 2.2e-112 100.0 similar to Rho ... Rattus norvegicus EDL14459 2.3e-112 100.0 Rho guanine nuc... Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK220313 4.8e-56 62.2 mFLJ00298 AK122280 9.6e-52 56.7 mKIAA0424 AK173168 1.2e-14 41.3 mKIAA1415 AK122468 5.5e-07 27.7 mKIAA1209 BC011462 3.8e-06 27.5 mKIAA4239

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001849	90	196	PF00169	Pleckstrin-like
HMMSmart	IPR001849	90	198	SM00233	Pleckstrin-like
ProfileScan	IPR000219	1	58	PS50010	DH
	IPR001849	89	196	PS50003	Pleckstrin-like
ScanRegExp	IPR001331	6	31	PS00741	Guanine-nucleotide dissociation stimulator

Method	From	To	amino acid sequence
-	-	-	-