ROUGE |
Gene/Protein Characteristic Table for mFLJ00285 |
Link to : NEDO | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK220312 |
---|---|
polycystin-1. | |
mfj26301 [Vector Info] | |
Source : | Mouse fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4830 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 0 bp Genome contig ID gi65550231f_22268688 PolyA signal sequence
(None) +----*----+----*----+----*----+----
GGGTGGCCTGAGTATCAGAACCAGTGAGCAGCAACFlanking genome sequence
(109667 - 109716) ----+----*----+----*----+----*----+----*----+----*
GATAGCATCTTTGTGGCAGCTGGCTCCACTCTACCCTTCTGGGGTCAGCT
KIAA Alignment based on: FLJ00285 DNA sequence
Features of the protein sequence |
Description | |
Coding region: 2316..4829
Length: 838 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage | |