Gene/Protein Characteristic Table for mFLJ00263

Length: 2268 bp

Restriction map

Length of 3'UTR	178 bp
Genome contig ID	gi65550231r_29554043
PolyA signal sequence (None)	+----*----+----*----+----*----+---- AACAAGCAATACGTTTGGTGTATGGGCTTTTTAGG
Flanking genome sequence (100000 - 99951)	----+----*----+----*----+----*----+----*----+----* ATTTTTGTTGTTGTTGTTTTTTGTTTTGTTTTCTCCTTGCACTGAGTGAC

KIAA	Alignment based on:
FLJ00263	DNA sequence, AA sequence, Physical map

Coding region: 3..2090

Length: 695 aa

Entry Exp ID% Protein Source BAD90128 0 100.0 mFLJ00263 prote... Mus musculus BAE24842 0 100.0 unnamed protein... Mus musculus EDL40340 0 99.6 SNF1-like kinas... Mus musculus Q60670 0 99.7 Serine/threonin... Mus musculus Q9R1U5 0 95.0 Serine/threonin... Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK122565 1.7e-31 35.2 mKIAA1860 AK220191 1.9e-31 37.0 mKIAA4207 AK220557 8.5e-31 49.8 mKIAA4230 AK173181 2.5e-30 37.4 mKIAA1477 BC020189 1e-23 32.3 mKIAA0096

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	1	194	PD000001	Protein kinase
HMMPfam	IPR000719	1	194	PF00069	Protein kinase
HMMSmart	IPR002290	1	194	SM00220	Serine/threonine protein kinase
	IPR001245	1	194	SM00219	Tyrosine protein kinase
ProfileScan	IPR000719	1	194	PS50011	Protein kinase
	IPR000449	219	259	PS50030	Ubiquitin-associated
ScanRegExp	IPR008271	61	73	PS00108	Serine/threonine protein kinase

Method	From	To	amino acid sequence
SOSUI	121	143	LDVWSLGVVLYVLVCGSLPFDGP