| ROUGE |
Gene/Protein Characteristic Table for mKIAA1860 |
| Link to : HUGE | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AK122565 |
|---|---|
| MAP/microtubule affinity-regulating kinase 4. MAP/microtubule affinity-regulating kinase 4L. MARK4 serine/threonine protein kinase. |
|
| mid04050 [Vector Info] | |
| Source : | Mouse adult pancreatic islet |
| Note : | We replaced mbg00138, former representative clones for mKIAA1860 with mid04050. (2004/6/22) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 2881 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 976 bp Genome contig ID gi65511124r_16194344 PolyA signal sequence
(None)
CGACTCCACGCTAGGCCCAGTTCTGGACATAAGAGFlanking genome sequence
(100000 - 99951)
ACGTACAGAGTCCGTCTGTGGGGAAGGGGCTGGAAGTGACCAGAACCCTG
KIAA Alignment based on: KIAA1860 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 1..1905
Length: 634 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage 
| |
