Gene/Protein Characteristic Table for mFLJ00193

Length: 2583 bp

Restriction map

Length of 3'UTR	1048 bp
Genome contig ID	gi65492966r_87394203
PolyA signal sequence (AATAAA,-23)	+----*----+----*----+----*----+---- GGGTAGTCACTCAATAAATGTTCCTCTAAAAGCTG
Flanking genome sequence (100000 - 99951)	----+----*----+----*----+----*----+----*----+----* AGTGGCTGAATCAAAGTACCAGCAATACCGTGTCCCCAGTGTCCCCCAGA

KIAA	Alignment based on:
FLJ00193	DNA sequence, AA sequence, Physical map

Coding region: 1..402, 510..1535

Length: 475 aa

Entry Exp ID% Protein Source BAD21401 5.2e-171 100.0 mFLJ00193 prote... Mus musculus BAE24560 1.4e-170 99.8 unnamed protein... Mus musculus Q8VIK5 1.6e-170 99.8 Platelet endoth... Mus musculus AAL38571 3.9e-170 99.6 Jedi protein [M... Mus musculus EDL15349 4.5e-170 99.4 RIKEN cDNA 3110... Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK122555 1.2e-18 34.4 mKIAA1781 AK173032 5.5e-17 42.6 mKIAA0815 AK129157 2.8e-09 31.8 mKIAA0533 AK220215 1.3e-08 28.0 mKIAA0149 AF290914 0.00017 32.1 mKIAA0246

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002049	27	45	PR00011	Laminin-type EGF-like
	IPR002049	113	131	PR00011	Laminin-type EGF-like
	IPR002049	156	174	PR00011	Laminin-type EGF-like
HMMPfam	NULL	19	45	PF07974	NULL
HMMSmart	IPR006210	14	46	SM00181	Type I EGF
	IPR002049	19	58	SM00180	Laminin-type EGF-like
	IPR006210	57	89	SM00181	Type I EGF
	IPR002049	61	101	SM00180	Laminin-type EGF-like
	IPR006210	100	132	SM00181	Type I EGF
	IPR002049	105	144	SM00180	Laminin-type EGF-like
	IPR006210	143	175	SM00181	Type I EGF
	IPR002049	148	192	SM00180	Laminin-type EGF-like
ProfileScan	NULL	2	165	PS50311	NULL
	IPR000694	434	469	PS50099	Proline-rich region
ScanRegExp	IPR006209	34	45	PS00022	EGF-like
	IPR006209	34	49	PS01186	EGF-like
	IPR006209	77	88	PS00022	EGF-like
	IPR006209	77	92	PS01186	EGF-like
	IPR006209	120	131	PS00022	EGF-like
	IPR006209	120	135	PS01186	EGF-like
	IPR006209	163	174	PS00022	EGF-like

Method	From	To	amino acid sequence
SOSUI	192	214	HNSLGAVIGIAVLGTLVVALIAL