ROUGE

Gene/Protein Characteristic Table for mFLJ00186

Link to : NEDO \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK131147
Description :	Ras association (RalGDS/AF-6) domain family 5. novel ras effector 1. Rap1-binding protein.
Clone Name :	mng13225 [Vector Info]
Source :	Mouse NKT cells

Features of the cloned DNA sequence	Description

Length: 2996 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2113 bp

Genome contig ID gi65488608r_130925885
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
TTTTTTAATGAGTAATAAAAGCTTACTGTAAAAAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAGTCACGATGGAATCGTCCTTGCTGAACGTCAACATCTTCTGGAAAGTG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

FLJ00186 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
FLJ00186	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..883
Length: 293 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD21397	1.2e-118	100.0	mFLJ00186 prote...	Mus musculus
BAC40546	5.5e-106	100.0	unnamed protein...	Mus musculus
AAL38592	4.7e-99	94.7	ras effector-li...	Homo sapiens
XP_001087526	8.7e-99	94.3	similar to Ras ...	Macaca mulatta
XP_001164384	2.9e-98	94.3	Ras association...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK172906	6.1e-10	26.0	mKIAA0168

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000159 149 239 PF00788 RA

HMMSmart IPR000159 147 239 SM00314 RA

ProfileScan IPR000159 163 239 PS50200 RA

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000159	149	239	PF00788	RA
HMMSmart	IPR000159	147	239	SM00314	RA
ProfileScan	IPR000159	163	239	PS50200	RA

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2113 bp
Genome contig ID	gi65488608r_130925885
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- TTTTTTAATGAGTAATAAAAGCTTACTGTAAAAAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGTCACGATGGAATCGTCCTTGCTGAACGTCAACATCTTCTGGAAAGTG

Gene/Protein Characteristic Table for mFLJ00186

Features of the cloned DNA sequence

Features of the protein sequence