ROUGE

Gene/Protein Characteristic Table for mKIAA0168

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK172906
Description :	Ras association (RalGDS/AF-6) domain family 2.
Clone Name :	mfj39332 [Vector Info]
Source :	Mouse fetal brain

Features of the cloned DNA sequence	Description

Length: 4556 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3499 bp

Genome contig ID gi66880554r_131406706
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
CTTAGACCTTATTTAAATAAAGCACTTTTGGAAGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
GAGCCCCTGTGGATCTGCTTTGAGCCTTTGGAGGGGAGCTCTGCTTCTGC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0168 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0168	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 62..1057
Length: 331 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q8BMS9	3e-131	100.0	Ras association...	Mus musculus
EDL80253	1.3e-128	97.9	Ras association...	Rattus norvegicus
Q3B7D5	3.3e-128	97.5	Ras association...	Rattus norvegicus
P50749	1.8e-121	92.6	Ras association...	Homo sapiens
XP_542904	1.8e-121	91.4	similar to Ras ...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK131147	1.8e-09	26.0	mFLJ00186

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000159 181 269 PF00788 RA

HMMSmart IPR000159 179 270 SM00314 RA

ProfileScan IPR000159 181 269 PS50200 RA

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000159	181	269	PF00788	RA
HMMSmart	IPR000159	179	270	SM00314	RA
ProfileScan	IPR000159	181	269	PS50200	RA

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	3499 bp
Genome contig ID	gi66880554r_131406706
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- CTTAGACCTTATTTAAATAAAGCACTTTTGGAAGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* GAGCCCCTGTGGATCTGCTTTGAGCCTTTGGAGGGGAGCTCTGCTTCTGC

Gene/Protein Characteristic Table for mKIAA0168

Features of the cloned DNA sequence

Features of the protein sequence