ROUGE |
Gene/Protein Characteristic Table for mFLJ00153 |
Link to : NEDO | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK131140 |
---|---|
RalGDS-like protein 3. Ral guanine-nucleotide exchange factor. ral guanine nucleotide dissociation stimulator like 3. |
|
mpm10098 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4632 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 2940 bp Genome contig ID gi65519420r_21758619 PolyA signal sequence
(AAGAAA,-22) +----*----+----*----+----*----+----
AATAATTCAAAGTAAGAAAGCCAAACCAACCAAACFlanking genome sequence
(99797 - 99748) ----+----*----+----*----+----*----+----*----+----*
AACAACAAGGAACATTCTTGGGTGTCTTGATTTTTTGGTCTCTGTCATAA
KIAA Alignment based on: FLJ00153 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 2..250, 349..1614
Length: 505 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |