ROUGE |
Gene/Protein Characteristic Table for mFLJ00080 |
Link to : NEDO | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AY167043 |
---|---|
rhomboid-like protein 6. | |
mkg00207 [Vector Info] | |
Source : | Mouse adult kidney |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3599 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 850 bp Genome contig ID gi65527427r_116319263 PolyA signal sequence
(ATTAAA,-20) +----*----+----*----+----*----+----
TGATGTCTCAAGTTTATTAAATGACATTCTTTATTFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAAATGCTGCCTTTTGCCTTAGACCTCCAAGAGAAGGAAAGCTAGAACTT
KIAA Alignment based on: FLJ00080 DNA sequence, AA sequence
Features of the protein sequence |
Description | |
Coding region: 101..2749
Length: 882 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |