ROUGE

Gene/Protein Characteristic Table for mKIAA4242

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220566
Description :	rhomboid family 1. epidermal growth factor receptor related sequence.
Clone Name :	mth01175 [Vector Info]
Source :	Mouse adult thymus

Features of the cloned DNA sequence	Description

Length: 5089 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 3181 bp

Genome contig ID gi65527427r_32004381
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
AATGGACTGGGAGCGTTTTAGCTGCCACTAACTCG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATGAGGATTTGTCACTGTTTCCTGATTTTTGGCTGGGGTCACGGGGGTAG

Genomic structure deduced by Blast search against draft genome sequences

Features of the protein sequence	Description

Coding region: 871..1905
Length: 345 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAL32367	1.5e-101	100.0	C16ORF8 [Mus mu...	Mus musculus
Q6PIX5	1.5e-101	100.0	Rhomboid family...	Mus musculus
EDL23763	3e-101	99.6	rhomboid family...	Mus musculus
Q499S9	4.6e-101	95.4	Rhomboid family...	Rattus norvegicus
AAH27346	5.3e-101	99.2	Rhomboid family...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AY167043	9.4e-34	47.1	mFLJ00080

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	3181 bp
Genome contig ID	gi65527427r_32004381
PolyA signal sequence (None)	+--------+--------+----*----+---- AATGGACTGGGAGCGTTTTAGCTGCCACTAACTCG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATGAGGATTTGTCACTGTTTCCTGATTTTTGGCTGGGGTCACGGGGGTAG

Gene/Protein Characteristic Table for mKIAA4242

Features of the cloned DNA sequence

Features of the protein sequence