ROUGE

Gene/Protein Characteristic Table for mFLJ00007

Link to : NEDO \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	BC057367
Description :	FCH and double SH3 domains 1.
Clone Name :	mfj33016 [Vector Info]
Source :	Mouse fetal brain

Features of the cloned DNA sequence	Description

Length: 4223 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2157 bp

Genome contig ID gi65551972r_38081155
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
CCCTTTGCCTGTAATAAATTCACTGTTAAGCCATG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGTGGTCATGTGTTCGTCCTTTCCACCCTGCTTACTAAAGAGAGCAATGC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

FLJ00007 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
FLJ00007	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..2066
Length: 687 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q6PFY1	0	100.0	FCH and double ...	Mus musculus
EDL10106	0	100.0	FCH and double ...	Mus musculus
EDL10101	0	99.7	FCH and double ...	Mus musculus
EDL76424	2.8e-210	96.7	FCH and double ...	Rattus norvegicus
XP_873649	2e-197	90.9	similar to FCH ...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK122368	2.5e-16	36.5	mKIAA0769

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001452 472 521 PD000066 SH3

IPR001452 549 596 PD000066 SH3

FPrintScan IPR001452 546 556 PR00452 SH3

IPR001452 560 575 PR00452 SH3

IPR001452 592 604 PR00452 SH3

HMMPfam IPR001060 15 104 PF00611 Cdc15/Fes/CIP4

IPR001452 468 524 PF00018 SH3

IPR011511 469 523 PF07653 Variant SH3

IPR001452 546 604 PF00018 SH3

IPR011511 547 604 PF07653 Variant SH3

HMMSmart IPR001060 15 104 SM00055 Cdc15/Fes/CIP4

IPR001452 468 525 SM00326 SH3

IPR001452 546 605 SM00326 SH3

ProfileScan IPR001060 11 74 PS50133 Cdc15/Fes/CIP4

IPR001452 472 526 PS50002 SH3

IPR001452 543 606 PS50002 SH3

IPR000694 607 685 PS50099 Proline-rich region

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001452	472	521	PD000066	SH3
IPR001452	549	596	PD000066	SH3
FPrintScan	IPR001452	546	556	PR00452	SH3
IPR001452	560	575	PR00452	SH3
IPR001452	592	604	PR00452	SH3
HMMPfam	IPR001060	15	104	PF00611	Cdc15/Fes/CIP4
IPR001452	468	524	PF00018	SH3
IPR011511	469	523	PF07653	Variant SH3
IPR001452	546	604	PF00018	SH3
IPR011511	547	604	PF07653	Variant SH3
HMMSmart	IPR001060	15	104	SM00055	Cdc15/Fes/CIP4
IPR001452	468	525	SM00326	SH3
IPR001452	546	605	SM00326	SH3
ProfileScan	IPR001060	11	74	PS50133	Cdc15/Fes/CIP4
IPR001452	472	526	PS50002	SH3
IPR001452	543	606	PS50002	SH3
IPR000694	607	685	PS50099	Proline-rich region

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2157 bp
Genome contig ID	gi65551972r_38081155
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- CCCTTTGCCTGTAATAAATTCACTGTTAAGCCATG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGTGGTCATGTGTTCGTCCTTTCCACCCTGCTTACTAAAGAGAGCAATGC

Gene/Protein Characteristic Table for mFLJ00007

Features of the cloned DNA sequence

Features of the protein sequence