ROUGE

Gene/Protein Characteristic Table for mKIAA0769

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122368
Description :	FCH and double SH3 domains 2. SH3 multiple domains 3.
Clone Name :	mbh03536 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 4296 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1865 bp

Genome contig ID gi65511124f_95115465
PolyA signal sequence
(AATAAA,-16)
+----*----+----*----+----*----+----
TATGTATAAAATGTTGAATAATAAAAAATGAAATT
Flanking genome sequence
(275490 - 275539)
----+----*----+----*----+----*----+----*----+----*
AAGTTTTGCAAGTGTCCTGATAAAGAGTTGATTAGGCAGGCTTTGAGAGA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0769 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0769	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 122..2431
Length: 769 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAH60647	0	100.0	FCH and double ...	Mus musculus
EDL16491	0	99.7	FCH and double ...	Mus musculus
EDM18299	8.4e-200	98.0	FCH and double ...	Rattus norvegicus
BAG59050	3.5e-197	96.9	unnamed protein...	Homo sapiens
EDL16489	9.4e-151	98.1	FCH and double ...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
BC057367	3.9e-17	36.5	mFLJ00007

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001452 502 555 PD000066 SH3

IPR001452 601 654 PD000066 SH3

FPrintScan IPR001452 599 609 PR00452 SH3

IPR001452 613 628 PR00452 SH3

IPR001452 644 656 PR00452 SH3

HMMPfam IPR001060 17 113 PF00611 Cdc15/Fes/CIP4

IPR001452 501 557 PF00018 SH3

IPR011511 502 557 PF07653 Variant SH3

IPR001452 599 656 PF00018 SH3

IPR011511 600 656 PF07653 Variant SH3

HMMSmart IPR001060 17 113 SM00055 Cdc15/Fes/CIP4

IPR001452 501 558 SM00326 SH3

IPR001452 599 657 SM00326 SH3

ProfileScan IPR001060 13 71 PS50133 Cdc15/Fes/CIP4

IPR001452 498 559 PS50002 SH3

IPR001452 596 658 PS50002 SH3

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001452	502	555	PD000066	SH3
IPR001452	601	654	PD000066	SH3
FPrintScan	IPR001452	599	609	PR00452	SH3
IPR001452	613	628	PR00452	SH3
IPR001452	644	656	PR00452	SH3
HMMPfam	IPR001060	17	113	PF00611	Cdc15/Fes/CIP4
IPR001452	501	557	PF00018	SH3
IPR011511	502	557	PF07653	Variant SH3
IPR001452	599	656	PF00018	SH3
IPR011511	600	656	PF07653	Variant SH3
HMMSmart	IPR001060	17	113	SM00055	Cdc15/Fes/CIP4
IPR001452	501	558	SM00326	SH3
IPR001452	599	657	SM00326	SH3
ProfileScan	IPR001060	13	71	PS50133	Cdc15/Fes/CIP4
IPR001452	498	559	PS50002	SH3
IPR001452	596	658	PS50002	SH3

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1865 bp
Genome contig ID	gi65511124f_95115465
PolyA signal sequence (AATAAA,-16)	+--------+--------+----*----+---- TATGTATAAAATGTTGAATAATAAAAAATGAAATT
Flanking genome sequence (275490 - 275539)	----+--------+--------+--------+--------+----* AAGTTTTGCAAGTGTCCTGATAAAGAGTTGATTAGGCAGGCTTTGAGAGA

Gene/Protein Characteristic Table for mKIAA0769

Features of the cloned DNA sequence

Features of the protein sequence