ROUGE |
Gene/Protein Characteristic Table for mFLJ00006 |
Link to : NEDO | InGAP | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | BC018197 |
---|---|
RUN and TBC1 domain containing 3. | |
mbj00080 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 2725 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 334 bp Genome contig ID gi65543215f_80930437 PolyA signal sequence
(AATAAA,-17) +----*----+----*----+----*----+----
GGCGGGGACATTATTGTAAATAAACCTTTTACTAGFlanking genome sequence
(134255 - 134304) ----+----*----+----*----+----*----+----*----+----*
AGCAAGCCTCCCATCTTTTGTTGAGCCAAGCCCTGAGTTCCACAAAAGCT
KIAA Alignment based on: FLJ00006 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 91..2391
Length: 766 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage ![]() | |