HUGE

Gene/Protein Characteristic Table for KIAA1965

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04278
Accession No. :	AB075845
Description :	BMP-binding endothelial regulator protein precursor.
HUGO Gene Name :
Clone Name :	pj02601 [Vector Info]
Source :	Human brain (hippocampus)

Features of the cloned DNA sequence	Description

Length: 4299 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2600 bp

Genome contig ID gi89161213f_33872656
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
AGATGACTTGAAATAAAAATGTTCTATGAATATTG
Flanking genome sequence
(289355 - 289404)
----+----*----+----*----+----*----+----*----+----*
AATTTGATGAGAAACAAGCACCCTCAATGAAGAACAAGCATAATTATGAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 7 f 33972656 34162009 12 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 565 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8N8U9	100.0	BMP-binding end...	Homo sapiens
AAH60868	100.0	BMPER protein [...	Homo sapiens
XP_519036	99.6	hypothetical pr...	Pan troglodytes
XP_001105988	98.8	similar to BMP-...	Macaca mulatta
XP_532513	95.2	similar to BMP-...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB111888	4.5e-20	33.7	KIAA2036
AB058677	0.00072	23.0	KIAA1781

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001007 46 104 PF00093 von Willebrand factor

IPR001007 118 169 PF00093 von Willebrand factor

IPR001007 181 237 PF00093 von Willebrand factor

IPR001846 244 394 PF00094 von Willebrand factor

IPR014853 433 505 PF08742 Domain of unknown function DUF1787

IPR002919 509 562 PF01826 Protease inhibitor I8

HMMSmart IPR001007 46 104 SM00214 von Willebrand factor

IPR001007 118 169 SM00214 von Willebrand factor

IPR001007 181 237 SM00214 von Willebrand factor

IPR001846 235 393 SM00216 von Willebrand factor

ProfileScan IPR001007 44 105 PS50184 von Willebrand factor

IPR001007 179 238 PS50184 von Willebrand factor

IPR001846 243 454 PS51233 von Willebrand factor

ScanRegExp IPR001007 66 104 PS01208 von Willebrand factor

IPR001007 199 237 PS01208 von Willebrand factor

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001007	46	104	PF00093	von Willebrand factor
IPR001007	118	169	PF00093	von Willebrand factor
IPR001007	181	237	PF00093	von Willebrand factor
IPR001846	244	394	PF00094	von Willebrand factor
IPR014853	433	505	PF08742	Domain of unknown function DUF1787
IPR002919	509	562	PF01826	Protease inhibitor I8
HMMSmart	IPR001007	46	104	SM00214	von Willebrand factor
IPR001007	118	169	SM00214	von Willebrand factor
IPR001007	181	237	SM00214	von Willebrand factor
IPR001846	235	393	SM00216	von Willebrand factor
ProfileScan	IPR001007	44	105	PS50184	von Willebrand factor
IPR001007	179	238	PS50184	von Willebrand factor
IPR001846	243	454	PS51233	von Willebrand factor
ScanRegExp	IPR001007	66	104	PS01208	von Willebrand factor
IPR001007	199	237	PS01208	von Willebrand factor

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GGCTACCTCTTGAAAGTGACC

Primer_r
: TCCATCTCCACCAATTAAGTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 7

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2600 bp
Genome contig ID	gi89161213f_33872656
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- AGATGACTTGAAATAAAAATGTTCTATGAATATTG
Flanking genome sequence (289355 - 289404)	----+--------+--------+--------+--------+----* AATTTGATGAGAAACAAGCACCCTCAATGAAGAACAAGCATAATTATGAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	7	f	33972656	34162009	12	99.3	Perfect prediction

Primer_f	: GGCTACCTCTTGAAAGTGACC
Primer_r	: TCCATCTCCACCAATTAAGTC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1965

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information