HUGE

Gene/Protein Characteristic Table for KIAA2009

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05971
Accession No. :	AB095929
Description :	RNA-binding protein MEX3B.
HUGO Gene Name :
Clone Name :	fj05611 [Vector Info]
Flexi ORF Clone :	pF1KA2009
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4333 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 1373 bp

Genome contig ID gi51511731r_80021183
PolyA signal sequence
(AATAAA,-15)
+----*----+----*----+----*----+----
TTTTTAAGTATTTCTATATAAATAAAATATTGAAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAATCTTATCTTGTGTGGTGACTTTTTTTTTAAGCCTCTTGGAATCTTA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 15 r 80121183 80125515 1 99.0 Perfect prediction

Features of the protein sequence	Description

Length: 501 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q6ZN04	4.1e-150	98.0	RNA-binding pro...	Homo sapiens
AAH36211	2e-149	97.6	MEX3B protein [...	Homo sapiens
XP_523137	3.4e-149	97.6	ring finger and...	Pan troglodytes
CAL38674	3.8e-149	97.4	hypothetical pr...	synthetic construct
CAL37893	3.8e-149	97.4	hypothetical pr...	synthetic construct

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB107353	3.2e-24	50.6	KIAA2031

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR004088 16 59 PF00013 K Homology

IPR004088 94 153 PF00013 K Homology

IPR001841 450 489 PF00097 Zinc finger

HMMSmart IPR004087 2 64 SM00322 K Homology

IPR004087 91 158 SM00322 K Homology

IPR001841 450 489 SM00184 Zinc finger

ProfileScan IPR004088 92 153 PS50084 K Homology

IPR001841 450 490 PS50089 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004088	16	59	PF00013	K Homology
IPR004088	94	153	PF00013	K Homology
IPR001841	450	489	PF00097	Zinc finger
HMMSmart	IPR004087	2	64	SM00322	K Homology
IPR004087	91	158	SM00322	K Homology
IPR001841	450	489	SM00184	Zinc finger
ProfileScan	IPR004088	92	153	PS50084	K Homology
IPR001841	450	490	PS50089	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TACATCAAGACCCCAGTTCGC

Primer_r
: TGAGTGCCGTGTTCTTATTCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 15

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	1373 bp
Genome contig ID	gi51511731r_80021183
PolyA signal sequence (AATAAA,-15)	+--------+--------+----*----+---- TTTTTAAGTATTTCTATATAAATAAAATATTGAAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAATCTTATCTTGTGTGGTGACTTTTTTTTTAAGCCTCTTGGAATCTTA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	15	r	80121183	80125515	1	99.0	Perfect prediction

Primer_f	: TACATCAAGACCCCAGTTCGC
Primer_r	: TGAGTGCCGTGTTCTTATTCC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA2009

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information