Gene/Protein Characteristic Table for KIAA2031

Length: 2441 bp

Restriction map

Length of 3'UTR	892 bp
Genome contig ID	gi42406306r_1405672
PolyA signal sequence (AATAAA,-24)	+----*----+----*----+----*----+---- AAAGCCTTCTTAATAAAGCCTCTTTTCTACATGTG
Flanking genome sequence (100000 - 99951)	----+----*----+----*----+----*----+----*----+----* AGCACACGGCTTCAGCGTGGTGTGGGGGATGGGCACCAGGAGGGGAGACC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	19	r	1505672	1518650	2	99.1	Perfect prediction

Length: 515 aa

Entry Exp ID% Protein Source Q86XN8 4.3e-170 100.0 RNA-binding pro... Homo sapiens XP_524036 6.1e-167 99.0 ring finger and... Pan troglodytes AAI13385 2.4e-154 99.6 MEX3D protein [... Homo sapiens AAQ04763 5.4e-154 99.6 bcl-2 ARE RNA b... Homo sapiens XP_583835 3.4e-127 86.0 similar to RNA-... Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% HUGE_ID AB095929 1.2e-25 50.4 KIAA2009

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004088	44	104	PF00013	K Homology
	IPR004088	139	198	PF00013	K Homology
	IPR001841	464	503	PF00097	Zinc finger
HMMSmart	IPR004087	41	109	SM00322	K Homology
	IPR004087	136	203	SM00322	K Homology
ProfileScan	IPR004088	52	104	PS50084	K Homology
	IPR004088	137	198	PS50084	K Homology
	IPR001841	464	504	PS50089	Zinc finger

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-