HUGE |
Gene/Protein Characteristic Table for KIAA2005 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00969 |
---|---|
Accession No. : | AB095926 |
Description : | Sterile alpha motif domain-containing protein 9-like. |
HUGO Gene Name : | sterile alpha motif domain containing 9-like (SAMD9L) |
Clone Name : | eg01633 [Vector Info] |
Flexi ORF Clone : | pF1KSDA2005 |
Source : |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 7122 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1162 bp Genome contig ID gi89161213r_92497304 PolyA signal sequence
(AATAAA,-26) +----*----+----*----+----*----+----
TGAATATTGAATAAAAAATATATTTATTTATCCACFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
ATCTTTGTATCTCTTTGTAATGTAACTTAGATATTCTGGACTCCAAACCC
Chr f/r start end exon identity class ContigView(URL based/DAS) 7 r 92597304 92615605 5 99.9 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1587 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: GAGAGATAAAGTGTACCTGTC | |
: ATAGACTGGACTGCTGCTGAG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 7 |
: genbank | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |