HUGE

Gene/Protein Characteristic Table for KIAA2004

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01700
Accession No. :	AB095925
Description :	Sterile alpha motif domain-containing protein 9.
HUGO Gene Name :	sterile alpha motif domain containing 9 (SAMD9)
Clone Name :	eg01144 [Vector Info]
Flexi ORF Clone :	pF1KA2004
Source :

Features of the cloned DNA sequence	Description

Length: 6803 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1829 bp

Genome contig ID gi89161213r_92466768
PolyA signal sequence
(ATTAAA,-23)
+----*----+----*----+----*----+----
TAAAAATTGTATATTAAAAAAAAAAAAAAAAAAAA
Flanking genome sequence
(87999 - 87950)
----+----*----+----*----+----*----+----*----+----*
AAAGACAAAAAACAATTTTGGTGAGAATGCAGACAAAGGAGAAGCCTCAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 7 r 92554767 92585206 4 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1595 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q5K651	100.0	Sterile alpha m...	Homo sapiens
XP_001167273	99.4	sterile alpha m...	Pan troglodytes
XP_001090497	95.2	similar to ster...	Macaca mulatta
XP_592017	80.2	sterile alpha m...	Bos taurus
XP_575365	76.4	similar to ster...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB095926	0	60.2	KIAA2005
AB028945	0.001	40.3	KIAA1022

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001660 18 70 PF00536 Sterile alpha motif SAM

HMMSmart IPR001660 17 83 SM00454 Sterile alpha motif SAM

ProfileScan IPR001660 20 66 PS50105 Sterile alpha motif SAM

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001660	18	70	PF00536	Sterile alpha motif SAM
HMMSmart	IPR001660	17	83	SM00454	Sterile alpha motif SAM
ProfileScan	IPR001660	20	66	PS50105	Sterile alpha motif SAM

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CCTTCACAAATACAGCAACAG

Primer_r
: AAATGGTTAATGAGGGCTTCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 7

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1829 bp
Genome contig ID	gi89161213r_92466768
PolyA signal sequence (ATTAAA,-23)	+--------+--------+----*----+---- TAAAAATTGTATATTAAAAAAAAAAAAAAAAAAAA
Flanking genome sequence (87999 - 87950)	----+--------+--------+--------+--------+----* AAAGACAAAAAACAATTTTGGTGAGAATGCAGACAAAGGAGAAGCCTCAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	7	r	92554767	92585206	4	100.0	Perfect prediction

Primer_f	: CCTTCACAAATACAGCAACAG
Primer_r	: AAATGGTTAATGAGGGCTTCC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA2004

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information