HUGE

Gene/Protein Characteristic Table for KIAA2017

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05745
Accession No. :	AB095937
Description :	dynein, axonemal, heavy chain 10 isoform 1.
HUGO Gene Name :
Clone Name :	fk13965y1 [Vector Info]
Source :	Human fetal brain
Note :	We replaced fk13965, former representative clones for KIAA2017 with fk13965y1. (2005/08/06)

Features of the cloned DNA sequence	Description

Length: 9388 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 232 bp

Genome contig ID gi89161190f_122783683
PolyA signal sequence
(AGTAAA,-17)
+----*----+----*----+----*----+----
GAATTTATATAATCAAAAAGTAAATATTGGAGAGT
Flanking genome sequence
(202532 - 202581)
----+----*----+----*----+----*----+----*----+----*
ATTTTAAGATGTGTGGAGTTTTCTTTTCCTTCTCAGAGAAAACACTTGAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 12 f 122883683 122986213 53 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 3051 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG06722	100.0	DNAH10 variant ...	Homo sapiens
Q8IVF4	100.0	Dynein heavy ch...	Homo sapiens
EAW98437	100.0	hCG1811879 [Hom...	Homo sapiens
NP_997320	100.0	dynein, axonema...	Homo sapiens
XP_001915485	93.5	dynein, axonema...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040936	0	39.6	KIAA1503
AB051484	1.2e-167	34.2	KIAA1697
AB002355	9.6e-132	37.7	KIAA0357
AB023161	1.9e-121	37.1	KIAA0944
AB046823	1.8e-116	35.7	KIAA1603

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR013602 1 244 PF08393 Dynein heavy chain

IPR011704 688 833 PF07728 ATPase associated with various cellular activities

IPR011704 1030 1177 PF07728 ATPase associated with various cellular activities

IPR004273 2338 3049 PF03028 Dynein heavy chain

HMMSmart IPR003593 406 542 SM00382 AAA+ ATPase

IPR003593 685 821 SM00382 AAA+ ATPase

IPR003593 1027 1180 SM00382 AAA+ ATPase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013602	1	244	PF08393	Dynein heavy chain
IPR011704	688	833	PF07728	ATPase associated with various cellular activities
IPR011704	1030	1177	PF07728	ATPase associated with various cellular activities
IPR004273	2338	3049	PF03028	Dynein heavy chain
HMMSmart	IPR003593	406	542	SM00382	AAA+ ATPase
IPR003593	685	821	SM00382	AAA+ ATPase
IPR003593	1027	1180	SM00382	AAA+ ATPase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CATCCTGTTCTTCGTCCTGTC

Primer_r
: AGCGTGTCCATGATGTTCCTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 12

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	232 bp
Genome contig ID	gi89161190f_122783683
PolyA signal sequence (AGTAAA,-17)	+--------+--------+----*----+---- GAATTTATATAATCAAAAAGTAAATATTGGAGAGT
Flanking genome sequence (202532 - 202581)	----+--------+--------+--------+--------+----* ATTTTAAGATGTGTGGAGTTTTCTTTTCCTTCTCAGAGAAAACACTTGAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	12	f	122883683	122986213	53	100.0	Perfect prediction

Primer_f	: CATCCTGTTCTTCGTCCTGTC
Primer_r	: AGCGTGTCCATGATGTTCCTC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA2017

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information