HUGE

Gene/Protein Characteristic Table for KIAA1990

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00964
Accession No. :	AB082521
Description :	pyruvate dehydrogenase phosphatase regulatory subunit.
HUGO Gene Name :
Clone Name :	bf00083 [Vector Info]
Flexi ORF Clone :	pF1KSDA1990
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 7999 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4402 bp

Genome contig ID gi51511732f_68605030
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CTCCAGCCTGGGTAACAGAGTGAGACTCTTGTCTC
Flanking genome sequence
(147657 - 147706)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAATCTAAGATAGAGGTTTGGTCAACAGTGCTTA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 16 f 68705030 68752685 19 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 883 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8NCN5	100.0	Pyruvate dehydr...	Homo sapiens
AAI50252	100.0	Pyruvate dehydr...	Homo sapiens
BAF85191	99.7	unnamed protein...	Homo sapiens
CAH10555	99.0	hypothetical pr...	Homo sapiens
XP_001108170	99.2	similar to pyru...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR006076 48 406 PF01266 FAD dependent oxidoreductase

IPR006222 527 744 PF01571 Glycine cleavage T protein (aminomethyl transferase)

IPR013977 751 860 PF08669 Glycine cleavage T-protein

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006076	48	406	PF01266	FAD dependent oxidoreductase
IPR006222	527	744	PF01571	Glycine cleavage T protein (aminomethyl transferase)
IPR013977	751	860	PF08669	Glycine cleavage T-protein

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ACGTGTGACTTCTGTTCTTAG

Primer_r
: GCTCAGCAGTTAGTGTTTGTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 16

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	4402 bp
Genome contig ID	gi51511732f_68605030
PolyA signal sequence (None)	+--------+--------+----*----+---- CTCCAGCCTGGGTAACAGAGTGAGACTCTTGTCTC
Flanking genome sequence (147657 - 147706)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAATCTAAGATAGAGGTTTGGTCAACAGTGCTTA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	16	f	68705030	68752685	19	100.0	Perfect prediction

Primer_f	: ACGTGTGACTTCTGTTCTTAG
Primer_r	: GCTCAGCAGTTAGTGTTTGTC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1990

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information