ROUGE

Gene/Protein Characteristic Table for mKIAA1990

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129472
Description :	pyruvate dehydrogenase phosphatase regulatory subunit.
Clone Name :	mbg13915 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 4938 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2062 bp

Genome contig ID gi65515060f_110292360
PolyA signal sequence
(AATACA,-29)
+----*----+----*----+----*----+----
ATACAAAATACATTTTTGAACTATGCATTACTTGT
Flanking genome sequence
(142435 - 142484)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAGTAGCAATCAGCAGGTTTGCTCTTTAAATATGGAAG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1990 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1990	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 219..2876
Length: 885 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q7TSQ8	99.9	Pyruvate dehydr...	Mus musculus
EDL92561	96.8	similar to pyru...	Rattus norvegicus
XP_001108170	92.5	similar to pyru...	Macaca mulatta
Q8NCN5	92.0	Pyruvate dehydr...	Homo sapiens
AAI50252	92.1	Pyruvate dehydr...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR006076 50 408 PF01266 FAD dependent oxidoreductase

IPR006222 529 869 PF01571 Glycine cleavage T protein (aminomethyl transferase)

ProfileScan IPR000205 51 80 PS50205 NAD-binding site

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006076	50	408	PF01266	FAD dependent oxidoreductase
IPR006222	529	869	PF01571	Glycine cleavage T protein (aminomethyl transferase)
ProfileScan	IPR000205	51	80	PS50205	NAD-binding site

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2062 bp
Genome contig ID	gi65515060f_110292360
PolyA signal sequence (AATACA,-29)	+--------+--------+----*----+---- ATACAAAATACATTTTTGAACTATGCATTACTTGT
Flanking genome sequence (142435 - 142484)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAGTAGCAATCAGCAGGTTTGCTCTTTAAATATGGAAG

Gene/Protein Characteristic Table for mKIAA1990

Features of the cloned DNA sequence

Features of the protein sequence