ROUGE |
Gene/Protein Characteristic Table for mKIAA1990 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK129472 |
---|---|
pyruvate dehydrogenase phosphatase regulatory subunit. | |
mbg13915 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4938 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 2062 bp Genome contig ID gi65515060f_110292360 PolyA signal sequence
(AATACA,-29) +----*----+----*----+----*----+----
ATACAAAATACATTTTTGAACTATGCATTACTTGTFlanking genome sequence
(142435 - 142484) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAGTAGCAATCAGCAGGTTTGCTCTTTAAATATGGAAG
KIAA Alignment based on: KIAA1990 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 219..2876
Length: 885 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |