HUGE

Gene/Protein Characteristic Table for KIAA1912

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00948
Accession No. :	AB067499
Description :	Coiled-coil domain-containing protein 85A.
HUGO Gene Name :	coiled-coil domain containing 85A (CCDC85A)
Clone Name :	fj18220 [Vector Info]
Flexi ORF Clone :	pF1KSDA1912
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4069 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1821 bp

Genome contig ID gi89161199f_56164678
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
CATCTTAGCAATGGTAATAAATTATTTAATCTCAC
Flanking genome sequence
(302136 - 302185)
----+----*----+----*----+----*----+----*----+----*
AGTGTCTTTGTCTTCTTCAAAATGTCTTTCCTAAATTGAGTCCATTTGTA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 f 56264762 56466812 6 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 589 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q96PX6	2e-173	100.0	Coiled-coil dom...	Homo sapiens
EAX00077	3.8e-173	99.8	hCG1994544, iso...	Homo sapiens
XP_525759	6.6e-171	98.6	coiled-coil dom...	Pan troglodytes
XP_001496018	1.6e-160	94.4	similar to Coil...	Equus caballus
XP_223723	7.3e-130	84.8	similar to Delt...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom NULL 72 211 PD035968 NULL

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	NULL	72	211	PD035968	NULL

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GTCAATCTCAAACAAGGTAGC

Primer_r
: AAAACACTGAGGCTCCACTGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1821 bp
Genome contig ID	gi89161199f_56164678
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- CATCTTAGCAATGGTAATAAATTATTTAATCTCAC
Flanking genome sequence (302136 - 302185)	----+--------+--------+--------+--------+----* AGTGTCTTTGTCTTCTTCAAAATGTCTTTCCTAAATTGAGTCCATTTGTA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	f	56264762	56466812	6	99.3	Perfect prediction

Primer_f	: GTCAATCTCAAACAAGGTAGC
Primer_r	: AAAACACTGAGGCTCCACTGG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1912

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information