HUGE

Gene/Protein Characteristic Table for KIAA1894

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04656
Accession No. :	AB067481
Description :	CUB and sushi domain-containing protein 3 precursor.
HUGO Gene Name :
Clone Name :	ff08107 [Vector Info]
Source :	Human fetal brain
Note :	We replaced fk04407, former representative clones for KIAA1894 with ff08107. (2003/8/28)

Features of the cloned DNA sequence	Description

Length: 10774 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1840 bp

Genome contig ID gi51511724r_113204337
PolyA signal sequence
(AATAAA,-25)
+----*----+----*----+----*----+----
ATGTAAACAAAATAAAAATGGATAATTGCTTTTGT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAATGTGTTTTTTTTTCCAAAAATAAACTGCAACTGTTCAGGTTAGTAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 8 r 113304337 113771447 56 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 2977 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAO34702	95.5	CUB and sushi m...	Homo sapiens
NP_443132	95.5	CUB and Sushi m...	Homo sapiens
EAW91946	95.5	CUB and Sushi m...	Homo sapiens
EAW91945	95.5	CUB and Sushi m...	Homo sapiens
XP_001063165	93.4	similar to CUB ...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB067477	6.4e-196	64.2	KIAA1890
AB067471	4.8e-184	48.4	KIAA1884
AB023144	5e-45	30.9	KIAA0927
AB023149	7.1e-10	27.9	KIAA0932
AB011539	7.9e-06	22.2	KIAA0815

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000436 4 57 PF00084 Sushi/SCR/CCP

IPR000859 61 166 PF00431 CUB

IPR000436 174 231 PF00084 Sushi/SCR/CCP

IPR000859 235 340 PF00431 CUB

IPR000436 350 403 PF00084 Sushi/SCR/CCP

IPR000859 407 514 PF00431 CUB

IPR000436 522 577 PF00084 Sushi/SCR/CCP

IPR000859 581 686 PF00431 CUB

IPR000436 694 750 PF00084 Sushi/SCR/CCP

IPR000859 754 860 PF00431 CUB

IPR000436 868 924 PF00084 Sushi/SCR/CCP

IPR000859 928 1033 PF00431 CUB

IPR000436 1041 1098 PF00084 Sushi/SCR/CCP

IPR000859 1102 1140 PF00431 CUB

IPR000436 1148 1205 PF00084 Sushi/SCR/CCP

IPR000859 1209 1314 PF00431 CUB

IPR000436 1322 1377 PF00084 Sushi/SCR/CCP

IPR000859 1381 1486 PF00431 CUB

IPR000436 1494 1549 PF00084 Sushi/SCR/CCP

IPR000859 1553 1657 PF00431 CUB

IPR000436 1665 1722 PF00084 Sushi/SCR/CCP

IPR000859 1734 1834 PF00431 CUB

IPR000436 1839 1897 PF00084 Sushi/SCR/CCP

IPR000436 1902 1959 PF00084 Sushi/SCR/CCP

IPR000436 1964 2024 PF00084 Sushi/SCR/CCP

IPR000436 2029 2082 PF00084 Sushi/SCR/CCP

IPR000436 2087 2140 PF00084 Sushi/SCR/CCP

IPR000436 2145 2198 PF00084 Sushi/SCR/CCP

IPR000436 2203 2260 PF00084 Sushi/SCR/CCP

IPR000436 2265 2318 PF00084 Sushi/SCR/CCP

IPR000436 2326 2379 PF00084 Sushi/SCR/CCP

IPR000436 2384 2438 PF00084 Sushi/SCR/CCP

IPR000436 2443 2498 PF00084 Sushi/SCR/CCP

IPR000436 2503 2556 PF00084 Sushi/SCR/CCP

IPR000436 2561 2614 PF00084 Sushi/SCR/CCP

IPR000436 2622 2676 PF00084 Sushi/SCR/CCP

IPR000436 2681 2736 PF00084 Sushi/SCR/CCP

HMMSmart IPR000436 4 57 SM00032 Sushi/SCR/CCP

IPR000859 61 169 SM00042 CUB

IPR000436 174 231 SM00032 Sushi/SCR/CCP

IPR000859 235 343 SM00042 CUB

IPR000436 350 403 SM00032 Sushi/SCR/CCP

IPR000859 407 517 SM00042 CUB

IPR000436 522 577 SM00032 Sushi/SCR/CCP

IPR000859 581 689 SM00042 CUB

IPR000436 694 750 SM00032 Sushi/SCR/CCP

IPR000859 754 863 SM00042 CUB

IPR000436 868 924 SM00032 Sushi/SCR/CCP

IPR000859 928 1036 SM00042 CUB

IPR000436 1041 1098 SM00032 Sushi/SCR/CCP

IPR000436 1148 1205 SM00032 Sushi/SCR/CCP

IPR000859 1209 1317 SM00042 CUB

IPR000436 1322 1377 SM00032 Sushi/SCR/CCP

IPR000859 1381 1489 SM00042 CUB

IPR000436 1494 1549 SM00032 Sushi/SCR/CCP

IPR000859 1553 1660 SM00042 CUB

IPR000436 1665 1722 SM00032 Sushi/SCR/CCP

IPR000859 1727 1837 SM00042 CUB

IPR000436 1839 1897 SM00032 Sushi/SCR/CCP

IPR000436 1902 1959 SM00032 Sushi/SCR/CCP

IPR000436 1964 2024 SM00032 Sushi/SCR/CCP

IPR000436 2029 2082 SM00032 Sushi/SCR/CCP

IPR000436 2087 2140 SM00032 Sushi/SCR/CCP

IPR000436 2145 2198 SM00032 Sushi/SCR/CCP

IPR000436 2203 2260 SM00032 Sushi/SCR/CCP

IPR000436 2265 2318 SM00032 Sushi/SCR/CCP

IPR000436 2326 2379 SM00032 Sushi/SCR/CCP

IPR000436 2384 2438 SM00032 Sushi/SCR/CCP

IPR000436 2443 2498 SM00032 Sushi/SCR/CCP

IPR000436 2503 2556 SM00032 Sushi/SCR/CCP

IPR000436 2561 2614 SM00032 Sushi/SCR/CCP

IPR000436 2622 2676 SM00032 Sushi/SCR/CCP

IPR000436 2681 2736 SM00032 Sushi/SCR/CCP

ProfileScan IPR000436 2 59 PS50923 Sushi/SCR/CCP

IPR000859 61 169 PS01180 CUB

IPR000436 172 233 PS50923 Sushi/SCR/CCP

IPR000859 235 343 PS01180 CUB

IPR000436 348 405 PS50923 Sushi/SCR/CCP

IPR000859 407 517 PS01180 CUB

IPR000436 520 579 PS50923 Sushi/SCR/CCP

IPR000859 581 689 PS01180 CUB

IPR000436 692 752 PS50923 Sushi/SCR/CCP

IPR000859 754 863 PS01180 CUB

IPR000436 866 926 PS50923 Sushi/SCR/CCP

IPR000859 928 1036 PS01180 CUB

IPR000436 1039 1100 PS50923 Sushi/SCR/CCP

IPR000859 1102 1135 PS01180 CUB

IPR000436 1146 1207 PS50923 Sushi/SCR/CCP

IPR000859 1209 1317 PS01180 CUB

IPR000436 1320 1379 PS50923 Sushi/SCR/CCP

IPR000859 1381 1489 PS01180 CUB

IPR000436 1492 1551 PS50923 Sushi/SCR/CCP

IPR000859 1553 1664 PS01180 CUB

IPR000436 1663 1724 PS50923 Sushi/SCR/CCP

IPR000859 1726 1837 PS01180 CUB

IPR000436 1837 1899 PS50923 Sushi/SCR/CCP

IPR000436 1900 1961 PS50923 Sushi/SCR/CCP

IPR000436 1962 2026 PS50923 Sushi/SCR/CCP

IPR000436 2027 2084 PS50923 Sushi/SCR/CCP

IPR000436 2085 2142 PS50923 Sushi/SCR/CCP

IPR000436 2143 2200 PS50923 Sushi/SCR/CCP

IPR000436 2201 2262 PS50923 Sushi/SCR/CCP

IPR000436 2263 2320 PS50923 Sushi/SCR/CCP

IPR000436 2324 2381 PS50923 Sushi/SCR/CCP

IPR000436 2382 2440 PS50923 Sushi/SCR/CCP

IPR000436 2441 2500 PS50923 Sushi/SCR/CCP

IPR000436 2501 2558 PS50923 Sushi/SCR/CCP

IPR000436 2559 2616 PS50923 Sushi/SCR/CCP

IPR000436 2620 2678 PS50923 Sushi/SCR/CCP

IPR000436 2679 2738 PS50923 Sushi/SCR/CCP

ScanRegExp IPR001000 509 519 PS00591 Glycoside hydrolase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000436	4	57	PF00084	Sushi/SCR/CCP
IPR000859	61	166	PF00431	CUB
IPR000436	174	231	PF00084	Sushi/SCR/CCP
IPR000859	235	340	PF00431	CUB
IPR000436	350	403	PF00084	Sushi/SCR/CCP
IPR000859	407	514	PF00431	CUB
IPR000436	522	577	PF00084	Sushi/SCR/CCP
IPR000859	581	686	PF00431	CUB
IPR000436	694	750	PF00084	Sushi/SCR/CCP
IPR000859	754	860	PF00431	CUB
IPR000436	868	924	PF00084	Sushi/SCR/CCP
IPR000859	928	1033	PF00431	CUB
IPR000436	1041	1098	PF00084	Sushi/SCR/CCP
IPR000859	1102	1140	PF00431	CUB
IPR000436	1148	1205	PF00084	Sushi/SCR/CCP
IPR000859	1209	1314	PF00431	CUB
IPR000436	1322	1377	PF00084	Sushi/SCR/CCP
IPR000859	1381	1486	PF00431	CUB
IPR000436	1494	1549	PF00084	Sushi/SCR/CCP
IPR000859	1553	1657	PF00431	CUB
IPR000436	1665	1722	PF00084	Sushi/SCR/CCP
IPR000859	1734	1834	PF00431	CUB
IPR000436	1839	1897	PF00084	Sushi/SCR/CCP
IPR000436	1902	1959	PF00084	Sushi/SCR/CCP
IPR000436	1964	2024	PF00084	Sushi/SCR/CCP
IPR000436	2029	2082	PF00084	Sushi/SCR/CCP
IPR000436	2087	2140	PF00084	Sushi/SCR/CCP
IPR000436	2145	2198	PF00084	Sushi/SCR/CCP
IPR000436	2203	2260	PF00084	Sushi/SCR/CCP
IPR000436	2265	2318	PF00084	Sushi/SCR/CCP
IPR000436	2326	2379	PF00084	Sushi/SCR/CCP
IPR000436	2384	2438	PF00084	Sushi/SCR/CCP
IPR000436	2443	2498	PF00084	Sushi/SCR/CCP
IPR000436	2503	2556	PF00084	Sushi/SCR/CCP
IPR000436	2561	2614	PF00084	Sushi/SCR/CCP
IPR000436	2622	2676	PF00084	Sushi/SCR/CCP
IPR000436	2681	2736	PF00084	Sushi/SCR/CCP
HMMSmart	IPR000436	4	57	SM00032	Sushi/SCR/CCP
IPR000859	61	169	SM00042	CUB
IPR000436	174	231	SM00032	Sushi/SCR/CCP
IPR000859	235	343	SM00042	CUB
IPR000436	350	403	SM00032	Sushi/SCR/CCP
IPR000859	407	517	SM00042	CUB
IPR000436	522	577	SM00032	Sushi/SCR/CCP
IPR000859	581	689	SM00042	CUB
IPR000436	694	750	SM00032	Sushi/SCR/CCP
IPR000859	754	863	SM00042	CUB
IPR000436	868	924	SM00032	Sushi/SCR/CCP
IPR000859	928	1036	SM00042	CUB
IPR000436	1041	1098	SM00032	Sushi/SCR/CCP
IPR000436	1148	1205	SM00032	Sushi/SCR/CCP
IPR000859	1209	1317	SM00042	CUB
IPR000436	1322	1377	SM00032	Sushi/SCR/CCP
IPR000859	1381	1489	SM00042	CUB
IPR000436	1494	1549	SM00032	Sushi/SCR/CCP
IPR000859	1553	1660	SM00042	CUB
IPR000436	1665	1722	SM00032	Sushi/SCR/CCP
IPR000859	1727	1837	SM00042	CUB
IPR000436	1839	1897	SM00032	Sushi/SCR/CCP
IPR000436	1902	1959	SM00032	Sushi/SCR/CCP
IPR000436	1964	2024	SM00032	Sushi/SCR/CCP
IPR000436	2029	2082	SM00032	Sushi/SCR/CCP
IPR000436	2087	2140	SM00032	Sushi/SCR/CCP
IPR000436	2145	2198	SM00032	Sushi/SCR/CCP
IPR000436	2203	2260	SM00032	Sushi/SCR/CCP
IPR000436	2265	2318	SM00032	Sushi/SCR/CCP
IPR000436	2326	2379	SM00032	Sushi/SCR/CCP
IPR000436	2384	2438	SM00032	Sushi/SCR/CCP
IPR000436	2443	2498	SM00032	Sushi/SCR/CCP
IPR000436	2503	2556	SM00032	Sushi/SCR/CCP
IPR000436	2561	2614	SM00032	Sushi/SCR/CCP
IPR000436	2622	2676	SM00032	Sushi/SCR/CCP
IPR000436	2681	2736	SM00032	Sushi/SCR/CCP
ProfileScan	IPR000436	2	59	PS50923	Sushi/SCR/CCP
IPR000859	61	169	PS01180	CUB
IPR000436	172	233	PS50923	Sushi/SCR/CCP
IPR000859	235	343	PS01180	CUB
IPR000436	348	405	PS50923	Sushi/SCR/CCP
IPR000859	407	517	PS01180	CUB
IPR000436	520	579	PS50923	Sushi/SCR/CCP
IPR000859	581	689	PS01180	CUB
IPR000436	692	752	PS50923	Sushi/SCR/CCP
IPR000859	754	863	PS01180	CUB
IPR000436	866	926	PS50923	Sushi/SCR/CCP
IPR000859	928	1036	PS01180	CUB
IPR000436	1039	1100	PS50923	Sushi/SCR/CCP
IPR000859	1102	1135	PS01180	CUB
IPR000436	1146	1207	PS50923	Sushi/SCR/CCP
IPR000859	1209	1317	PS01180	CUB
IPR000436	1320	1379	PS50923	Sushi/SCR/CCP
IPR000859	1381	1489	PS01180	CUB
IPR000436	1492	1551	PS50923	Sushi/SCR/CCP
IPR000859	1553	1664	PS01180	CUB
IPR000436	1663	1724	PS50923	Sushi/SCR/CCP
IPR000859	1726	1837	PS01180	CUB
IPR000436	1837	1899	PS50923	Sushi/SCR/CCP
IPR000436	1900	1961	PS50923	Sushi/SCR/CCP
IPR000436	1962	2026	PS50923	Sushi/SCR/CCP
IPR000436	2027	2084	PS50923	Sushi/SCR/CCP
IPR000436	2085	2142	PS50923	Sushi/SCR/CCP
IPR000436	2143	2200	PS50923	Sushi/SCR/CCP
IPR000436	2201	2262	PS50923	Sushi/SCR/CCP
IPR000436	2263	2320	PS50923	Sushi/SCR/CCP
IPR000436	2324	2381	PS50923	Sushi/SCR/CCP
IPR000436	2382	2440	PS50923	Sushi/SCR/CCP
IPR000436	2441	2500	PS50923	Sushi/SCR/CCP
IPR000436	2501	2558	PS50923	Sushi/SCR/CCP
IPR000436	2559	2616	PS50923	Sushi/SCR/CCP
IPR000436	2620	2678	PS50923	Sushi/SCR/CCP
IPR000436	2679	2738	PS50923	Sushi/SCR/CCP
ScanRegExp	IPR001000	509	519	PS00591	Glycoside hydrolase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 2900 SVAIAILVPFFALIFAGFGF 2919 PRIMARY 20

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	2900	SVAIAILVPFFALIFAGFGF	2919	PRIMARY	20

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ATTATTCAGTGAGCTATGGGG

Primer_r
: GGATGGTAAGTTTGGTGTCTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 8

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1840 bp
Genome contig ID	gi51511724r_113204337
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- ATGTAAACAAAATAAAAATGGATAATTGCTTTTGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAATGTGTTTTTTTTTCCAAAAATAAACTGCAACTGTTCAGGTTAGTAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	8	r	113304337	113771447	56	99.8	Perfect prediction

Primer_f	: ATTATTCAGTGAGCTATGGGG
Primer_r	: GGATGGTAAGTTTGGTGTCTC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1894

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information