HUGE

Gene/Protein Characteristic Table for KIAA1884

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04655
Accession No. :	AB067471
Description :	CUB and sushi domain-containing protein 2.
HUGO Gene Name :	CUB and Sushi multiple domains 2 (CSMD2)
Clone Name :	fh04567 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5463 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2620 bp

Genome contig ID gi89161185r_33652260
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
TTTTGAATTCAAATAAAATATAAATTTTTGCATTG
Flanking genome sequence
(99936 - 99887)
----+----*----+----*----+----*----+----*----+----*
GTTTTCTTACATTTTTATGGCCTCTTTCATGACTAGGGGCAAGTGTTTGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 r 33752196 33810839 20 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 946 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAO34701	100.0	CUB and sushi m...	Homo sapiens
Q7Z408	99.9	CUB and sushi d...	Homo sapiens
EAX07450	99.8	CUB and Sushi m...	Homo sapiens
XP_851846	92.2	similar to CUB ...	Canis lupus fam...
BAD97692	86.5	CSMD2 protein [...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB067481	1e-170	48.3	KIAA1894
AB067477	1.3e-09	23.0	KIAA1890
AB023144	1.7e-06	23.0	KIAA0927

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000436 3 47 PF00084 Sushi/SCR/CCP

IPR000436 52 112 PF00084 Sushi/SCR/CCP

IPR000436 117 170 PF00084 Sushi/SCR/CCP

IPR000436 175 228 PF00084 Sushi/SCR/CCP

IPR000436 233 286 PF00084 Sushi/SCR/CCP

IPR000436 294 347 PF00084 Sushi/SCR/CCP

IPR000436 352 406 PF00084 Sushi/SCR/CCP

IPR000436 411 466 PF00084 Sushi/SCR/CCP

IPR000436 471 524 PF00084 Sushi/SCR/CCP

IPR000436 529 582 PF00084 Sushi/SCR/CCP

IPR000436 590 644 PF00084 Sushi/SCR/CCP

IPR000436 649 704 PF00084 Sushi/SCR/CCP

HMMSmart IPR000436 2 47 SM00032 Sushi/SCR/CCP

IPR000436 52 112 SM00032 Sushi/SCR/CCP

IPR000436 117 170 SM00032 Sushi/SCR/CCP

IPR000436 175 228 SM00032 Sushi/SCR/CCP

IPR000436 233 286 SM00032 Sushi/SCR/CCP

IPR000436 294 347 SM00032 Sushi/SCR/CCP

IPR000436 352 406 SM00032 Sushi/SCR/CCP

IPR000436 411 466 SM00032 Sushi/SCR/CCP

IPR000436 471 524 SM00032 Sushi/SCR/CCP

IPR000436 529 582 SM00032 Sushi/SCR/CCP

IPR000436 590 644 SM00032 Sushi/SCR/CCP

IPR000436 649 704 SM00032 Sushi/SCR/CCP

ProfileScan IPR000436 1 49 PS50923 Sushi/SCR/CCP

IPR000436 50 114 PS50923 Sushi/SCR/CCP

IPR000436 115 172 PS50923 Sushi/SCR/CCP

IPR000436 173 230 PS50923 Sushi/SCR/CCP

IPR000436 231 288 PS50923 Sushi/SCR/CCP

IPR000436 292 349 PS50923 Sushi/SCR/CCP

IPR000436 350 408 PS50923 Sushi/SCR/CCP

IPR000436 409 468 PS50923 Sushi/SCR/CCP

IPR000436 469 526 PS50923 Sushi/SCR/CCP

IPR000436 527 584 PS50923 Sushi/SCR/CCP

IPR000436 588 646 PS50923 Sushi/SCR/CCP

IPR000436 647 706 PS50923 Sushi/SCR/CCP

ScanRegExp IPR003006 318 324 PS00290 Immunoglobulin/major histocompatibility complex motif

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000436	3	47	PF00084	Sushi/SCR/CCP
IPR000436	52	112	PF00084	Sushi/SCR/CCP
IPR000436	117	170	PF00084	Sushi/SCR/CCP
IPR000436	175	228	PF00084	Sushi/SCR/CCP
IPR000436	233	286	PF00084	Sushi/SCR/CCP
IPR000436	294	347	PF00084	Sushi/SCR/CCP
IPR000436	352	406	PF00084	Sushi/SCR/CCP
IPR000436	411	466	PF00084	Sushi/SCR/CCP
IPR000436	471	524	PF00084	Sushi/SCR/CCP
IPR000436	529	582	PF00084	Sushi/SCR/CCP
IPR000436	590	644	PF00084	Sushi/SCR/CCP
IPR000436	649	704	PF00084	Sushi/SCR/CCP
HMMSmart	IPR000436	2	47	SM00032	Sushi/SCR/CCP
IPR000436	52	112	SM00032	Sushi/SCR/CCP
IPR000436	117	170	SM00032	Sushi/SCR/CCP
IPR000436	175	228	SM00032	Sushi/SCR/CCP
IPR000436	233	286	SM00032	Sushi/SCR/CCP
IPR000436	294	347	SM00032	Sushi/SCR/CCP
IPR000436	352	406	SM00032	Sushi/SCR/CCP
IPR000436	411	466	SM00032	Sushi/SCR/CCP
IPR000436	471	524	SM00032	Sushi/SCR/CCP
IPR000436	529	582	SM00032	Sushi/SCR/CCP
IPR000436	590	644	SM00032	Sushi/SCR/CCP
IPR000436	649	704	SM00032	Sushi/SCR/CCP
ProfileScan	IPR000436	1	49	PS50923	Sushi/SCR/CCP
IPR000436	50	114	PS50923	Sushi/SCR/CCP
IPR000436	115	172	PS50923	Sushi/SCR/CCP
IPR000436	173	230	PS50923	Sushi/SCR/CCP
IPR000436	231	288	PS50923	Sushi/SCR/CCP
IPR000436	292	349	PS50923	Sushi/SCR/CCP
IPR000436	350	408	PS50923	Sushi/SCR/CCP
IPR000436	409	468	PS50923	Sushi/SCR/CCP
IPR000436	469	526	PS50923	Sushi/SCR/CCP
IPR000436	527	584	PS50923	Sushi/SCR/CCP
IPR000436	588	646	PS50923	Sushi/SCR/CCP
IPR000436	647	706	PS50923	Sushi/SCR/CCP
ScanRegExp	IPR003006	318	324	PS00290	Immunoglobulin/major histocompatibility complex motif

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 868 SSVAAAILVPFIALIIAGFVLYL 890 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	868	SSVAAAILVPFIALIIAGFVLYL	890	PRIMARY	23

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CCTTGCGAGTGGGTTTGATTG

Primer_r
: GCCAGCATGTCACACGTATAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2620 bp
Genome contig ID	gi89161185r_33652260
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- TTTTGAATTCAAATAAAATATAAATTTTTGCATTG
Flanking genome sequence (99936 - 99887)	----+--------+--------+--------+--------+----* GTTTTCTTACATTTTTATGGCCTCTTTCATGACTAGGGGCAAGTGTTTGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	r	33752196	33810839	20	99.5	Perfect prediction

Primer_f	: CCTTGCGAGTGGGTTTGATTG
Primer_r	: GCCAGCATGTCACACGTATAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1884

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information