HUGE

Gene/Protein Characteristic Table for KIAA1890

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04654
Accession No. :	AB067477
Description :	CUB and sushi domain-containing protein 1 precursor.
HUGO Gene Name :	CUB and Sushi multiple domains 1 (CSMD1)
Clone Name :	fk02692 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 3289 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 142 bp

Genome contig ID gi51511724r_2896176
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
GTGGCGTACAGATTTAAATAAAGCTTTGGCAGAGT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AACTTTGAGAGTGGAAAACTTATTTGAAAAATCAATTAAGCCATGCAACT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 8 r 2996176 3212178 21 100.0 Terminal No-hit

Features of the protein sequence	Description

Length: 1048 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAQ88541	100.0	CSMD1 [Homo sap...	Homo sapiens
BAD92739	100.0	CUB and Sushi m...	Homo sapiens
EAW80463	100.0	CUB and Sushi m...	Homo sapiens
NP_150094	100.0	CUB and Sushi m...	Homo sapiens
Q96PZ7	99.9	CUB and sushi d...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB067481	9.2e-211	64.2	KIAA1894
AB023144	4.9e-54	32.3	KIAA0927
AB023149	4.6e-16	25.3	KIAA0932
AB067471	1.5e-11	23.0	KIAA1884
AB011541	7.1e-06	27.7	KIAA0817

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000436 81 136 PF00084 Sushi/SCR/CCP

IPR000859 140 245 PF00431 CUB

IPR000436 253 309 PF00084 Sushi/SCR/CCP

IPR000859 313 419 PF00431 CUB

IPR000436 427 483 PF00084 Sushi/SCR/CCP

IPR000859 487 592 PF00431 CUB

IPR000436 600 657 PF00084 Sushi/SCR/CCP

IPR000859 661 766 PF00431 CUB

IPR000436 777 834 PF00084 Sushi/SCR/CCP

IPR000859 838 943 PF00431 CUB

IPR000436 951 1006 PF00084 Sushi/SCR/CCP

IPR000859 1010 1046 PF00431 CUB

HMMSmart IPR000436 81 136 SM00032 Sushi/SCR/CCP

IPR000859 140 248 SM00042 CUB

IPR000436 253 309 SM00032 Sushi/SCR/CCP

IPR000859 313 422 SM00042 CUB

IPR000436 427 483 SM00032 Sushi/SCR/CCP

IPR000859 487 595 SM00042 CUB

IPR000436 600 657 SM00032 Sushi/SCR/CCP

IPR000859 661 769 SM00042 CUB

IPR000436 777 834 SM00032 Sushi/SCR/CCP

IPR000859 838 946 SM00042 CUB

IPR000436 951 1006 SM00032 Sushi/SCR/CCP

ProfileScan IPR000436 79 138 PS50923 Sushi/SCR/CCP

IPR000859 140 248 PS01180 CUB

IPR000436 251 311 PS50923 Sushi/SCR/CCP

IPR000859 313 422 PS01180 CUB

IPR000436 425 485 PS50923 Sushi/SCR/CCP

IPR000859 487 595 PS01180 CUB

IPR000436 598 659 PS50923 Sushi/SCR/CCP

IPR000859 661 769 PS01180 CUB

IPR000436 775 836 PS50923 Sushi/SCR/CCP

IPR000859 838 946 PS01180 CUB

IPR000436 949 1008 PS50923 Sushi/SCR/CCP

IPR000859 1010 1048 PS01180 CUB

ScanRegExp IPR001000 68 78 PS00591 Glycoside hydrolase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000436	81	136	PF00084	Sushi/SCR/CCP
IPR000859	140	245	PF00431	CUB
IPR000436	253	309	PF00084	Sushi/SCR/CCP
IPR000859	313	419	PF00431	CUB
IPR000436	427	483	PF00084	Sushi/SCR/CCP
IPR000859	487	592	PF00431	CUB
IPR000436	600	657	PF00084	Sushi/SCR/CCP
IPR000859	661	766	PF00431	CUB
IPR000436	777	834	PF00084	Sushi/SCR/CCP
IPR000859	838	943	PF00431	CUB
IPR000436	951	1006	PF00084	Sushi/SCR/CCP
IPR000859	1010	1046	PF00431	CUB
HMMSmart	IPR000436	81	136	SM00032	Sushi/SCR/CCP
IPR000859	140	248	SM00042	CUB
IPR000436	253	309	SM00032	Sushi/SCR/CCP
IPR000859	313	422	SM00042	CUB
IPR000436	427	483	SM00032	Sushi/SCR/CCP
IPR000859	487	595	SM00042	CUB
IPR000436	600	657	SM00032	Sushi/SCR/CCP
IPR000859	661	769	SM00042	CUB
IPR000436	777	834	SM00032	Sushi/SCR/CCP
IPR000859	838	946	SM00042	CUB
IPR000436	951	1006	SM00032	Sushi/SCR/CCP
ProfileScan	IPR000436	79	138	PS50923	Sushi/SCR/CCP
IPR000859	140	248	PS01180	CUB
IPR000436	251	311	PS50923	Sushi/SCR/CCP
IPR000859	313	422	PS01180	CUB
IPR000436	425	485	PS50923	Sushi/SCR/CCP
IPR000859	487	595	PS01180	CUB
IPR000436	598	659	PS50923	Sushi/SCR/CCP
IPR000859	661	769	PS01180	CUB
IPR000436	775	836	PS50923	Sushi/SCR/CCP
IPR000859	838	946	PS01180	CUB
IPR000436	949	1008	PS50923	Sushi/SCR/CCP
IPR000859	1010	1048	PS01180	CUB
ScanRegExp	IPR001000	68	78	PS00591	Glycoside hydrolase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CCCAGCTATGACTTCCTACAC

Primer_r
: GTCAAAACAAGCTTCCCGTGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 8

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	142 bp
Genome contig ID	gi51511724r_2896176
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- GTGGCGTACAGATTTAAATAAAGCTTTGGCAGAGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACTTTGAGAGTGGAAAACTTATTTGAAAAATCAATTAAGCCATGCAACT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	8	r	2996176	3212178	21	100.0	Terminal No-hit

Primer_f	: CCCAGCTATGACTTCCTACAC
Primer_r	: GTCAAAACAAGCTTCCCGTGG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1890

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information