ROUGE |
Gene/Protein Characteristic Table for mKIAA1781 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK122555 |
---|---|
mbg19640 [Vector Info] | |
Source : | Mouse brain |
Note : | We replaced mbg06605, former representative clones for mKIAA1781 with mbg19640. (2004/6/22) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6680 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 3255 bp Genome contig ID gi65519420f_64407878 PolyA signal sequence
(AATAAA,-29) +----*----+----*----+----*----+----
ATACAAAATAAAATGGATTCTCAAACTAACATTACFlanking genome sequence
(423531 - 423580) ----+----*----+----*----+----*----+----*----+----*
AAGAATGCCTACTGTTGTGTTGCAAACTGAAAATCTATACATTTTATGTT
KIAA Alignment based on: KIAA1781 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 3..3425
Length: 1140 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |