| HUGE |
Gene/Protein Characteristic Table for KIAA1748 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00909 |
|---|---|
| Accession No. : | AB051535 |
| Description : | Probable palmitoyltransferase ZDHHC5. |
| HUGO Gene Name : | zinc finger, DHHC-type containing 5 (ZDHHC5) |
| Clone Name : | pj02084 [Vector Info] |
| Flexi ORF Clone : | pF1KSDA1748
![]() |
| Source : | Human brain (hippocampus) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4545 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1149 bp Genome contig ID gi51511727f_57092058 PolyA signal sequence
(AATAAA,-21) +----*----+----*----+----*----+----
TTAAACCAACGAGGAATAAAAAGAAATCCTGATCTFlanking genome sequence
(133172 - 133221) ----+----*----+----*----+----*----+----*----+----*
AACCAGCGCCCCCTGACTTGTGTTATTTTGTCTGGTTGAGACAGGGTGAA
Chr f/r start end exon identity class ContigView(URL based/DAS) 11 f 57192058 57225228 12 99.7 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 758 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|

Experimental conditions
| : AGTTGCAATCCATTCGTTCAG | |
| : GGTATAGCCTAAAGGTGGGTC | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 11 |
| : unigene | |
| : - | |
| : - | |
| : - | |
| : - |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |