HUGE

Gene/Protein Characteristic Table for KIAA1292

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :
Accession No. :	AB033118
Description :	Probable palmitoyltransferase ZDHHC8.
HUGO Gene Name :	zinc finger, DHHC-type containing 8 (ZDHHC8)
Clone Name :	hk05468 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4311 bp
Physical map
Restriction map
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
Comparison between the cloned and the revised DNA sequences.
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq. revised DNA seq.
Warning for N-terminal truncation:
YES YES

Warning for coding interruption:
YES NO

Integrity of 3' end

Length of 3'UTR 1050 bp

Genome contig ID gi89161203f_18407008
PolyA signal sequence
(ATTAAA,-18)
+----*----+----*----+----*----+----
TATATATCTATAATTTTATTAAAAAAAAGAAAAAG
Flanking genome sequence
(106967 - 107016)
----+----*----+----*----+----*----+----*----+----*
AGTTATTTTGATTCTTTCCTTGGGCAAGGCCAGGGCTATTGCTGCAGGAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 22 f 18507008 18513973 7 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 595 aa
This protein sequence is predicted from the revised DNA sequence

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAX02982	1.6e-182	99.8	zinc finger, DH...	Homo sapiens
CAG30243	1.2e-164	86.5	Em:AC006547.5 [...	Homo sapiens
Q9ULC8	1.3e-164	86.5	Probable palmit...	Homo sapiens
Q2THX0	5.1e-155	82.6	Probable palmit...	Pan troglodytes
Q2THW8	2.2e-151	79.8	Probable palmit...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051535	7.1e-05	37.3	KIAA1748

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001594 24 50 PD003041 Zinc finger

HMMPfam IPR001594 17 64 PF01529 Zinc finger

ProfileScan IPR001594 26 49 PS50216 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001594	24	50	PD003041	Zinc finger
HMMPfam	IPR001594	17	64	PF01529	Zinc finger
ProfileScan	IPR001594	26	49	PS50216	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TGGTGGTGGATAGGTGGACAG

Primer_r
: TTGATGAAAGGGACAGCGGCG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 22

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TGGTGGTGGATAGGTGGACAG
Primer_r	: TTGATGAAAGGGACAGCGGCG
PCR product length	: 140 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.	revised DNA seq.
Warning for N-terminal truncation:	YES	YES
Warning for coding interruption:	YES	NO

Length of 3'UTR	1050 bp
Genome contig ID	gi89161203f_18407008
PolyA signal sequence (ATTAAA,-18)	+--------+--------+----*----+---- TATATATCTATAATTTTATTAAAAAAAAGAAAAAG
Flanking genome sequence (106967 - 107016)	----+--------+--------+--------+--------+----* AGTTATTTTGATTCTTTCCTTGGGCAAGGCCAGGGCTATTGCTGCAGGAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	22	f	18507008	18513973	7	99.2	Perfect prediction

Gene/Protein Characteristic Table for KIAA1292

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information