| HUGE |
Gene/Protein Characteristic Table for KIAA1671 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00884 |
|---|---|
| Accession No. : | AB051458 |
| Description : | K1671_HUMAN Isoform 2 of Q9BY89 - Homo sapiens. |
| HUGO Gene Name : | |
| Clone Name : | hh02164 [Vector Info] |
| Flexi ORF Clone : | pF1KSDA1671
![]() |
| Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 6123 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 5028 bp Genome contig ID gi89161203f_23696180 PolyA signal sequence
(AATAAA,-22) +----*----+----*----+----*----+----
TATGAAAATAGCAAATAAAGCTTTGGTGCAAGTTGFlanking genome sequence
(227227 - 227276) ----+----*----+----*----+----*----+----*----+----*
CATTGGAGAAGTCGGTGCGTCCATGTGTGAATGAATAGAGTCTCCCATGC
Chr f/r start end exon identity class ContigView(URL based/DAS) 22 f 23796180 23923405 8 99.1 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 364 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
| Motif_DB | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| None | - | - | - | - | - |
| Method | No. | N terminal | transmembrane region | C terminal | type | length |
|---|---|---|---|---|---|---|
| - | - | - | - | - | - | - |
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|

RH mapping information |
Description | |
|---|---|---|
| : 22 |
| : genbank | |
| : - | |
| : - | |
| : - | |
| : - |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |