HUGE |
Gene/Protein Characteristic Table for KIAA1741 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00274 |
---|---|
Accession No. : | AB051528 |
Description : | 182 kDa tankyrase 1-binding protein. |
HUGO Gene Name : | tankyrase 1 binding protein 1, 182kDa (TNKS1BP1) |
Clone Name : | fh23254 [Vector Info] |
Flexi ORF Clone : | pF1KA1741
![]() |
Source : | Human fetal brain |
Note : | We replaced pj01271, former representative clones for KIAA1741 with fh23254. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5785 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 450 bp Genome contig ID gi51511727r_56723694 PolyA signal sequence
(AATAAA,-16) +----*----+----*----+----*----+----
TTTGCCACTTGAAACAATAAATAAAGTTTTTTGGGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AATTGGTGCTGTCCAGGTGGTGGTACGTGGTCATGGCTGCCCATTTCCTC
Chr f/r start end exon identity class ContigView(URL based/DAS) 11 r 56823694 56848969 12 99.6 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1777 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Motif_DB | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
None | - | - | - | - | - |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: CTCAGGGTCAGAAGGATCGTC | |
: ATAAATGTGCCTCCCCAGACG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 11 |
: unigene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |