HUGE |
Gene/Protein Characteristic Table for KIAA1664 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00262 |
---|---|
Accession No. : | AB051451 |
Description : | Oxysterol-binding protein 2. |
HUGO Gene Name : | oxysterol binding protein 2 (OSBP2) |
Clone Name : | fj04751s1 [Vector Info] |
Flexi ORF Clone : | pF1KA1664
![]() |
Source : | Human fetal brain |
Note : | We replaced fj04751, former representative clones for KIAA1664 with fj04751s1. (2005/08/06) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4244 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 1481 bp Genome contig ID gi89161203f_29320885 PolyA signal sequence
(AATAAA,-29) +----*----+----*----+----*----+----
ACCAGTAATAAAAAACCTTGGCTTTGGAGTTTTCCFlanking genome sequence
(312924 - 312973) ----+----*----+----*----+----*----+----*----+----*
ACTGCCCTGTCCCTCAGTCTCTGTGTATCTGGGTGGAGGGGACTAATGTA
Chr f/r start end exon identity class ContigView(URL based/DAS) 22 f 29420885 29633807 14 99.8 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 920 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001849 | 187 | 278 | PF00169 | Pleckstrin-like |
IPR000648 | 488 | 910 | PF01237 | Oxysterol-binding protein | |
HMMSmart | IPR001849 | 187 | 280 | SM00233 | Pleckstrin-like |
ProfileScan | IPR001849 | 186 | 278 | PS50003 | Pleckstrin-like |
ScanRegExp | IPR000648 | 626 | 636 | PS01013 | Oxysterol-binding protein |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
RH mapping information |
Description | |
---|---|---|
: 22 |
: genbank | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |