HUGE

Gene/Protein Characteristic Table for KIAA0704

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01603
Accession No. :	AB014604
Description :	Oxysterol-binding protein-related protein 3.
HUGO Gene Name :	oxysterol binding protein-like 3 (OSBPL3)
Clone Name :	hg02921s2 [Vector Info]
Flexi ORF Clone :	pF1KSDA0704
Source :	Human adult brain
Note :	We replaced hg02921, former representative clones for KIAA0704 with hg02921s2. (2002/12/27)

Features of the cloned DNA sequence	Description

Length: 6137 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3060 bp

Genome contig ID gi89161213r_24703267
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
AGCCTAAAAAGTAATAAAGTTTTTATTTGGCTGTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
GAACCTTGATGTAGCCCCTACTACATACACTACAAGTTATGCCTTCTGGC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 7 r 24803267 24986293 23 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 919 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9H4L5	100.0	Oxysterol-bindi...	Homo sapiens
XP_001160186	100.0	oxysterol-bindi...	Pan troglodytes
XP_001160094	96.5	oxysterol-bindi...	Pan troglodytes
XP_539480	94.2	similar to oxys...	Canis lupus fam...
XP_001916289	94.4	oxysterol bindi...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018315	4.2e-35	38.4	KIAA0772
AB051451	3.1e-33	33.5	KIAA1664
AB040967	2e-14	26.8	KIAA1534
AB040884	4e-12	23.7	KIAA1451

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001849 84 178 PF00169 Pleckstrin-like

IPR000648 520 907 PF01237 Oxysterol-binding protein

HMMSmart IPR001849 84 180 SM00233 Pleckstrin-like

ProfileScan IPR001849 83 178 PS50003 Pleckstrin-like

ScanRegExp IPR000648 659 670 PS01013 Oxysterol-binding protein

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001849	84	178	PF00169	Pleckstrin-like
IPR000648	520	907	PF01237	Oxysterol-binding protein
HMMSmart	IPR001849	84	180	SM00233	Pleckstrin-like
ProfileScan	IPR001849	83	178	PS50003	Pleckstrin-like
ScanRegExp	IPR000648	659	670	PS01013	Oxysterol-binding protein

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: CTGTTTGGGCATCCTGGGTAC

Primer_r
: TGTAGCAGGAGAGCCAGTCAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 7

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CTGTTTGGGCATCCTGGGTAC
Primer_r	: TGTAGCAGGAGAGCCAGTCAC
PCR product length	: 204 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	3060 bp
Genome contig ID	gi89161213r_24703267
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- AGCCTAAAAAGTAATAAAGTTTTTATTTGGCTGTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* GAACCTTGATGTAGCCCCTACTACATACACTACAAGTTATGCCTTCTGGC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	7	r	24803267	24986293	23	99.5	Perfect prediction

Gene/Protein Characteristic Table for KIAA0704

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information