HUGE

Gene/Protein Characteristic Table for KIAA1620

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06502
Accession No. :	AB046840
Description :	Periaxin.
HUGO Gene Name :	periaxin (PRX)
Clone Name :	hj04150 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4790 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 200 bp

Genome contig ID gi42406306r_45491513
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
ACCAAGCCATGTGAATAAAATAATCTGGAAGTAGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
CATGTATTTGTCTCCTCTGTGTGCATAGGGGGCAGGGAGGGGCAGGAGTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 19 r 45591513 45602035 4 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 1398 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW56962	95.2	periaxin, isofo...	Homo sapiens
Q9BXM0	95.2	Periaxin.	Homo sapiens
NP_870998	95.3	periaxin isofor...	Homo sapiens
EAW56963	94.9	periaxin, isofo...	Homo sapiens
AAH68135	75.2	Prx protein [Mu...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020652	7.9e-07	28.1	KIAA0845
AB018297	4.6e-06	24.6	KIAA0754
AB095939	0.00043	25.5	KIAA2019

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR004829 455 520 PD153432 Cell surface antigen

IPR004829 531 594 PD153432 Cell surface antigen

IPR004829 642 700 PD153432 Cell surface antigen

IPR004829 730 784 PD153432 Cell surface antigen

HMMPfam IPR001478 20 69 PF00595 PDZ/DHR/GLGF

HMMSmart IPR001478 30 102 SM00228 PDZ/DHR/GLGF

ProfileScan IPR001478 18 87 PS50106 PDZ/DHR/GLGF

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR004829	455	520	PD153432	Cell surface antigen
IPR004829	531	594	PD153432	Cell surface antigen
IPR004829	642	700	PD153432	Cell surface antigen
IPR004829	730	784	PD153432	Cell surface antigen
HMMPfam	IPR001478	20	69	PF00595	PDZ/DHR/GLGF
HMMSmart	IPR001478	30	102	SM00228	PDZ/DHR/GLGF
ProfileScan	IPR001478	18	87	PS50106	PDZ/DHR/GLGF

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TGCAATGCGCCGAGCCTTACA

Primer_r
: AAAGGAGAACTCGACGTCAAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 19

Experimental conditions

Panel name	: RH-map
Primer_f	: ACAGCAGGCTACAGGGTTCAG
Primer_r	: AAAGACACCCTCACCCACCAG
PCR product length	: 96 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	200 bp
Genome contig ID	gi42406306r_45491513
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- ACCAAGCCATGTGAATAAAATAATCTGGAAGTAGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* CATGTATTTGTCTCCTCTGTGTGCATAGGGGGCAGGGAGGGGCAGGAGTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	19	r	45591513	45602035	4	99.2	Perfect prediction

Primer_f	: TGCAATGCGCCGAGCCTTACA
Primer_r	: AAAGGAGAACTCGACGTCAAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1620

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information